Incidental Mutation 'R1397:Rnpepl1'
ID160169
Institutional Source Beutler Lab
Gene Symbol Rnpepl1
Ensembl Gene ENSMUSG00000026269
Gene Namearginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92910783-92924384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92917159 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 391 (T391N)
Ref Sequence ENSEMBL: ENSMUSP00000027487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027487] [ENSMUST00000178116]
Predicted Effect probably damaging
Transcript: ENSMUST00000027487
AA Change: T391N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027487
Gene: ENSMUSG00000026269
AA Change: T391N

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
Pfam:Peptidase_M1 36 440 3e-58 PFAM
Leuk-A4-hydro_C 523 668 1.31e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178116
SMART Domains Protein: ENSMUSP00000136080
Gene: ENSMUSG00000026269

DomainStartEndE-ValueType
Pfam:Peptidase_M1 5 170 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178816
Predicted Effect unknown
Transcript: ENSMUST00000179127
AA Change: T56N
Predicted Effect probably benign
Transcript: ENSMUST00000179531
Predicted Effect unknown
Transcript: ENSMUST00000179837
AA Change: T4N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179854
Predicted Effect probably benign
Transcript: ENSMUST00000179993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180306
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Rnpepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Rnpepl1 APN 1 92915899 missense possibly damaging 0.69
IGL01291:Rnpepl1 APN 1 92919746 missense probably benign
IGL02266:Rnpepl1 APN 1 92916889 missense probably damaging 1.00
IGL02481:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL02483:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL03377:Rnpepl1 APN 1 92919231 missense probably benign 0.01
ANU05:Rnpepl1 UTSW 1 92919746 missense probably benign
R0069:Rnpepl1 UTSW 1 92918898 missense possibly damaging 0.91
R0409:Rnpepl1 UTSW 1 92915860 missense probably damaging 1.00
R0479:Rnpepl1 UTSW 1 92918865 unclassified probably benign
R1155:Rnpepl1 UTSW 1 92916887 missense probably damaging 1.00
R1170:Rnpepl1 UTSW 1 92919195 missense possibly damaging 0.56
R1601:Rnpepl1 UTSW 1 92917222 missense possibly damaging 0.95
R2184:Rnpepl1 UTSW 1 92916823 missense probably benign 0.43
R2187:Rnpepl1 UTSW 1 92916895 missense probably null 1.00
R2211:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R2902:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3105:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3196:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R3439:Rnpepl1 UTSW 1 92916940 missense possibly damaging 0.94
R4887:Rnpepl1 UTSW 1 92915113 missense probably damaging 1.00
R4966:Rnpepl1 UTSW 1 92916761 missense probably damaging 1.00
R5212:Rnpepl1 UTSW 1 92911323 missense probably benign 0.03
R5214:Rnpepl1 UTSW 1 92919279 missense probably benign 0.01
R5385:Rnpepl1 UTSW 1 92917192 missense probably damaging 1.00
R5655:Rnpepl1 UTSW 1 92919310 missense probably damaging 1.00
R5694:Rnpepl1 UTSW 1 92918941 missense probably benign 0.03
R5940:Rnpepl1 UTSW 1 92917712 missense probably damaging 1.00
R6046:Rnpepl1 UTSW 1 92916821 missense probably damaging 1.00
R6086:Rnpepl1 UTSW 1 92917681 missense probably damaging 1.00
R6104:Rnpepl1 UTSW 1 92915884 missense probably benign
R6349:Rnpepl1 UTSW 1 92919841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGCACCAATTGCAAGGGGCAC -3'
(R):5'- TGGAAACCAGTTCTCAGACCCTGTG -3'

Sequencing Primer
(F):5'- ACAGAGCCCTGCCTAGC -3'
(R):5'- CCTGGCAAGGCAGTGAAC -3'
Posted On2014-03-14