Incidental Mutation 'R1397:Slc28a2'
ID160175
Institutional Source Beutler Lab
Gene Symbol Slc28a2
Ensembl Gene ENSMUSG00000027219
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 2
SynonymsCNT2, 2010208B10Rik
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1397 (G1)
Quality Score94
Status Validated
Chromosome2
Chromosomal Location122426477-122461137 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 122460531 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 659 (C659*)
Ref Sequence ENSEMBL: ENSMUSP00000106154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028652] [ENSMUST00000110524] [ENSMUST00000110525]
Predicted Effect probably null
Transcript: ENSMUST00000028652
AA Change: C659*
SMART Domains Protein: ENSMUSP00000028652
Gene: ENSMUSG00000027219
AA Change: C659*

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 1.5e-28 PFAM
Pfam:Gate 260 360 7.9e-11 PFAM
Pfam:Nucleos_tra2_C 363 587 1e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110524
AA Change: C659*
SMART Domains Protein: ENSMUSP00000106153
Gene: ENSMUSG00000027219
AA Change: C659*

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 254 8.6e-26 PFAM
Pfam:Gate 260 387 2.5e-9 PFAM
Pfam:Nucleos_tra2_C 363 588 5.1e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110525
AA Change: C659*
SMART Domains Protein: ENSMUSP00000106154
Gene: ENSMUSG00000027219
AA Change: C659*

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 254 8.6e-26 PFAM
Pfam:Gate 260 387 2.5e-9 PFAM
Pfam:Nucleos_tra2_C 363 588 5.1e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153848
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Slc28a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Slc28a2 APN 2 122452057 missense probably damaging 1.00
IGL01404:Slc28a2 APN 2 122452057 missense probably damaging 1.00
IGL01559:Slc28a2 APN 2 122454540 missense probably damaging 1.00
IGL02016:Slc28a2 APN 2 122455341 missense probably benign 0.01
IGL02503:Slc28a2 APN 2 122458212 missense probably benign 0.00
IGL02576:Slc28a2 APN 2 122458171 missense probably damaging 0.99
IGL02948:Slc28a2 APN 2 122457977 missense possibly damaging 0.70
IGL03006:Slc28a2 APN 2 122452538 missense possibly damaging 0.65
IGL03061:Slc28a2 APN 2 122454499 missense probably damaging 1.00
R0028:Slc28a2 UTSW 2 122451602 missense probably damaging 1.00
R0240:Slc28a2 UTSW 2 122454527 missense probably benign
R0240:Slc28a2 UTSW 2 122454527 missense probably benign
R0427:Slc28a2 UTSW 2 122458221 missense probably benign 0.02
R0502:Slc28a2 UTSW 2 122458281 critical splice donor site probably null
R0981:Slc28a2 UTSW 2 122450984 missense probably damaging 1.00
R1229:Slc28a2 UTSW 2 122460531 nonsense probably null
R1641:Slc28a2 UTSW 2 122455617 missense probably damaging 1.00
R1713:Slc28a2 UTSW 2 122451013 missense probably damaging 1.00
R1732:Slc28a2 UTSW 2 122449758 splice site probably benign
R1765:Slc28a2 UTSW 2 122460395 intron probably null
R1955:Slc28a2 UTSW 2 122447866 missense probably benign
R1996:Slc28a2 UTSW 2 122455562 missense probably damaging 1.00
R2299:Slc28a2 UTSW 2 122441778 nonsense probably null
R2300:Slc28a2 UTSW 2 122441778 nonsense probably null
R2510:Slc28a2 UTSW 2 122451016 nonsense probably null
R4038:Slc28a2 UTSW 2 122454515 missense probably benign 0.03
R4893:Slc28a2 UTSW 2 122455216 intron probably null
R5011:Slc28a2 UTSW 2 122457890 missense possibly damaging 0.94
R5013:Slc28a2 UTSW 2 122457890 missense possibly damaging 0.94
R5185:Slc28a2 UTSW 2 122458194 missense probably benign 0.04
R6317:Slc28a2 UTSW 2 122454499 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCGTGAGAAGCCAAGTTCGTTC -3'
(R):5'- TGTCATGCCGCTGGAAAGGTAAG -3'

Sequencing Primer
(F):5'- TGACAACAGATCTATGCACAGTAG -3'
(R):5'- GTAAGGGCTGATTTTTATACAGAGC -3'
Posted On2014-03-14