Incidental Mutation 'R1397:Rhbg'
ID160177
Institutional Source Beutler Lab
Gene Symbol Rhbg
Ensembl Gene ENSMUSG00000104445
Gene NameRhesus blood group-associated B glycoprotein
Synonyms
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88242874-88254709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88248446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 66 (V66I)
Ref Sequence ENSEMBL: ENSMUSP00000130767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171887]
Predicted Effect probably benign
Transcript: ENSMUST00000163277
Predicted Effect unknown
Transcript: ENSMUST00000165196
AA Change: V44I
SMART Domains Protein: ENSMUSP00000132187
Gene: ENSMUSG00000103766
AA Change: V44I

DomainStartEndE-ValueType
Pfam:Ammonium_transp 1 353 9.7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171887
AA Change: V66I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130767
Gene: ENSMUSG00000104445
AA Change: V66I

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:Ammonium_transp 22 419 5.9e-74 PFAM
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-erythroid members of the Rhesus (Rh) protein family. Non-erythroid Rh protein family members are mainly expressed in the kidney and belong to the methylammonium-ammonium permease/ammonia transporters superfamily. All Rh family proteins are predicted to be transmembrane proteins with 12 membrane spanning domains and intracytoplasmic N- and C-termini. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, do not develop hyperammonemic hepatic encephalopathy or distal tubular acidosis, and show a normal renal response to chronic acid-loading and no changes in NH4+ or NH3 entry across the basolateral membrane of cortical collecting ducts cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Rhbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Rhbg UTSW 3 88254498 missense probably benign
R0786:Rhbg UTSW 3 88244568 missense probably benign 0.04
R1737:Rhbg UTSW 3 88245874 missense probably damaging 1.00
R1927:Rhbg UTSW 3 88244552 missense probably benign 0.00
R2088:Rhbg UTSW 3 88247458 missense probably damaging 1.00
R3976:Rhbg UTSW 3 88244536 missense probably damaging 1.00
R4056:Rhbg UTSW 3 88243448 missense probably damaging 1.00
R4669:Rhbg UTSW 3 88245966 missense probably damaging 1.00
R4878:Rhbg UTSW 3 88247453 missense probably benign 0.43
R5032:Rhbg UTSW 3 88245134 missense probably damaging 1.00
R5330:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5331:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5788:Rhbg UTSW 3 88245567 missense probably benign 0.00
R6293:Rhbg UTSW 3 88245826 nonsense probably null
R6882:Rhbg UTSW 3 88245220 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCCCTTGTGAAGTGATGG -3'
(R):5'- TCCAGGCTGAATGCTTTGTTCCG -3'

Sequencing Primer
(F):5'- GCCCACTCTAGGTTGAAACAGTAG -3'
(R):5'- CTCCTGGTGGGAGGCTG -3'
Posted On2014-03-14