Incidental Mutation 'R1397:Trim33'
ID160178
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 103310434 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860]
Predicted Effect probably benign
Transcript: ENSMUST00000029444
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106860
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197779
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Excision UTSW 3 103344576 missense probably damaging 1.00
Peaked UTSW 3 103337532 critical splice donor site probably null
R0143:Trim33 UTSW 3 103352101 missense probably benign 0.00
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0573:Trim33 UTSW 3 103351990 splice site probably benign
R0586:Trim33 UTSW 3 103310344 missense probably damaging 0.99
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R3878:Trim33 UTSW 3 103352005 missense probably damaging 1.00
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4809:Trim33 UTSW 3 103329256 missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6636:Trim33 UTSW 3 103353719 missense probably damaging 1.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R6856:Trim33 UTSW 3 103352049 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGAAGAACATTAACCCCTGCTTCCTC -3'
(R):5'- TCAATGCATGTCTTACACAGCCACTC -3'

Sequencing Primer
(F):5'- TCCTCTTCTTTTTTTTAAAGTTGGTG -3'
(R):5'- ACCAACTGCACTTGCATTATC -3'
Posted On2014-03-14