Incidental Mutation 'R1397:Srrm1'
ID160180
Institutional Source Beutler Lab
Gene Symbol Srrm1
Ensembl Gene ENSMUSG00000028809
Gene Nameserine/arginine repetitive matrix 1
SynonymsSRm160
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135320484-135353321 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 135321431 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030613] [ENSMUST00000084846] [ENSMUST00000105861] [ENSMUST00000136342]
Predicted Effect probably benign
Transcript: ENSMUST00000030613
SMART Domains Protein: ENSMUSP00000030613
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 4.31e-5 PROSPERO
internal_repeat_1 427 456 3.46e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 3.46e-6 PROSPERO
internal_repeat_3 670 693 4.31e-5 PROSPERO
internal_repeat_4 684 698 4.31e-5 PROSPERO
internal_repeat_2 689 734 4.31e-5 PROSPERO
internal_repeat_3 719 740 4.31e-5 PROSPERO
internal_repeat_5 730 740 8.09e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 4.31e-5 PROSPERO
internal_repeat_5 808 818 8.09e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 886 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000084846
AA Change: D891E
SMART Domains Protein: ENSMUSP00000081906
Gene: ENSMUSG00000028809
AA Change: D891E

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 402 N/A INTRINSIC
internal_repeat_2 404 450 3.57e-5 PROSPERO
internal_repeat_1 422 451 2.79e-6 PROSPERO
low complexity region 471 495 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 550 656 N/A INTRINSIC
internal_repeat_1 661 695 2.79e-6 PROSPERO
internal_repeat_3 665 688 3.57e-5 PROSPERO
internal_repeat_4 679 693 3.57e-5 PROSPERO
internal_repeat_2 684 729 3.57e-5 PROSPERO
internal_repeat_3 714 735 3.57e-5 PROSPERO
internal_repeat_5 725 735 6.75e-5 PROSPERO
low complexity region 741 790 N/A INTRINSIC
internal_repeat_4 794 808 3.57e-5 PROSPERO
internal_repeat_5 803 813 6.75e-5 PROSPERO
low complexity region 822 846 N/A INTRINSIC
low complexity region 849 886 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105861
AA Change: D882E
SMART Domains Protein: ENSMUSP00000101487
Gene: ENSMUSG00000028809
AA Change: D882E

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 1.99e-5 PROSPERO
internal_repeat_1 427 456 1.45e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 539 647 N/A INTRINSIC
internal_repeat_1 652 686 1.45e-6 PROSPERO
internal_repeat_3 656 679 1.99e-5 PROSPERO
internal_repeat_4 670 684 1.99e-5 PROSPERO
internal_repeat_2 675 720 1.99e-5 PROSPERO
internal_repeat_3 705 726 1.99e-5 PROSPERO
internal_repeat_5 716 726 3.82e-5 PROSPERO
low complexity region 732 781 N/A INTRINSIC
internal_repeat_4 785 799 1.99e-5 PROSPERO
internal_repeat_5 794 804 3.82e-5 PROSPERO
low complexity region 813 837 N/A INTRINSIC
low complexity region 840 877 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136342
AA Change: D896E
SMART Domains Protein: ENSMUSP00000125003
Gene: ENSMUSG00000028809
AA Change: D896E

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 3.36e-5 PROSPERO
internal_repeat_1 427 456 2.61e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 2.61e-6 PROSPERO
internal_repeat_3 670 693 3.36e-5 PROSPERO
internal_repeat_4 684 698 3.36e-5 PROSPERO
internal_repeat_2 689 734 3.36e-5 PROSPERO
internal_repeat_3 719 740 3.36e-5 PROSPERO
internal_repeat_5 730 740 6.37e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 3.36e-5 PROSPERO
internal_repeat_5 808 818 6.37e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 891 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136570
Predicted Effect probably benign
Transcript: ENSMUST00000140050
SMART Domains Protein: ENSMUSP00000120952
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 2 107 N/A INTRINSIC
internal_repeat_1 116 145 9.96e-7 PROSPERO
internal_repeat_1 165 196 9.96e-7 PROSPERO
low complexity region 202 225 N/A INTRINSIC
low complexity region 257 281 N/A INTRINSIC
low complexity region 284 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150619
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Srrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Srrm1 APN 4 135347207 splice site probably null
IGL02070:Srrm1 APN 4 135325104 missense unknown
IGL02073:Srrm1 APN 4 135325104 missense unknown
IGL02193:Srrm1 APN 4 135325104 missense unknown
IGL02232:Srrm1 APN 4 135353116 start codon destroyed probably null 1.00
IGL02377:Srrm1 APN 4 135325104 missense unknown
IGL02379:Srrm1 APN 4 135325104 missense unknown
IGL02380:Srrm1 APN 4 135325104 missense unknown
IGL02382:Srrm1 APN 4 135325104 missense unknown
IGL02386:Srrm1 APN 4 135325104 missense unknown
IGL02387:Srrm1 APN 4 135325104 missense unknown
IGL02393:Srrm1 APN 4 135321414 unclassified probably benign
IGL02436:Srrm1 APN 4 135325104 missense unknown
IGL02438:Srrm1 APN 4 135325104 missense unknown
IGL02439:Srrm1 APN 4 135325104 missense unknown
IGL02440:Srrm1 APN 4 135325104 missense unknown
IGL02500:Srrm1 APN 4 135325104 missense unknown
IGL02561:Srrm1 APN 4 135325104 missense unknown
IGL02562:Srrm1 APN 4 135325104 missense unknown
IGL02566:Srrm1 APN 4 135325104 missense unknown
IGL02567:Srrm1 APN 4 135325104 missense unknown
IGL02568:Srrm1 APN 4 135325104 missense unknown
IGL02569:Srrm1 APN 4 135325104 missense unknown
IGL02570:Srrm1 APN 4 135325104 missense unknown
IGL02572:Srrm1 APN 4 135325104 missense unknown
IGL02583:Srrm1 APN 4 135325104 missense unknown
IGL02584:Srrm1 APN 4 135325104 missense unknown
IGL02585:Srrm1 APN 4 135325104 missense unknown
IGL02586:Srrm1 APN 4 135325104 missense unknown
IGL02587:Srrm1 APN 4 135325104 missense unknown
IGL02588:Srrm1 APN 4 135325104 missense unknown
IGL02589:Srrm1 APN 4 135325104 missense unknown
IGL02596:Srrm1 APN 4 135325104 missense unknown
IGL02597:Srrm1 APN 4 135325104 missense unknown
IGL02601:Srrm1 APN 4 135325104 missense unknown
IGL02602:Srrm1 APN 4 135325104 missense unknown
IGL02609:Srrm1 APN 4 135325104 missense unknown
IGL02614:Srrm1 APN 4 135325104 missense unknown
IGL02631:Srrm1 APN 4 135325104 missense unknown
IGL02632:Srrm1 APN 4 135325104 missense unknown
IGL02657:Srrm1 APN 4 135325104 missense unknown
IGL02658:Srrm1 APN 4 135325104 missense unknown
IGL02659:Srrm1 APN 4 135325104 missense unknown
IGL02660:Srrm1 APN 4 135325104 missense unknown
IGL02677:Srrm1 APN 4 135325104 missense unknown
IGL02683:Srrm1 APN 4 135325104 missense unknown
IGL02686:Srrm1 APN 4 135325104 missense unknown
IGL02690:Srrm1 APN 4 135325104 missense unknown
IGL02713:Srrm1 APN 4 135325104 missense unknown
IGL02723:Srrm1 APN 4 135325104 missense unknown
IGL02724:Srrm1 APN 4 135325104 missense unknown
IGL02725:Srrm1 APN 4 135325104 missense unknown
IGL02730:Srrm1 APN 4 135325104 missense unknown
IGL02731:Srrm1 APN 4 135325104 missense unknown
IGL02732:Srrm1 APN 4 135325104 missense unknown
IGL02733:Srrm1 APN 4 135325104 missense unknown
IGL02734:Srrm1 APN 4 135325104 missense unknown
IGL02743:Srrm1 APN 4 135325104 missense unknown
IGL02744:Srrm1 APN 4 135325104 missense unknown
IGL02752:Srrm1 APN 4 135325104 missense unknown
Serious UTSW 4 135340926 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0132:Srrm1 UTSW 4 135340573 nonsense probably null
R0510:Srrm1 UTSW 4 135338543 intron probably benign
R0691:Srrm1 UTSW 4 135324991 nonsense probably null
R1337:Srrm1 UTSW 4 135346733 critical splice donor site probably null
R2883:Srrm1 UTSW 4 135321411 unclassified probably benign
R4043:Srrm1 UTSW 4 135340931 unclassified probably benign
R4772:Srrm1 UTSW 4 135342379 unclassified probably benign
R4837:Srrm1 UTSW 4 135345512 intron probably benign
R4975:Srrm1 UTSW 4 135346720 splice site probably benign
R5401:Srrm1 UTSW 4 135324069 splice site probably benign
R6144:Srrm1 UTSW 4 135337873 unclassified probably benign
R6542:Srrm1 UTSW 4 135340926 nonsense probably null
R7147:Srrm1 UTSW 4 135346826 missense not run
Predicted Primers PCR Primer
(F):5'- ACACCGTGGACGCCTTTGTAATG -3'
(R):5'- TCCCTAAGCTGTCTTGCCTAGAGC -3'

Sequencing Primer
(F):5'- GTGGACGCCTTTGTAATGTAAATCC -3'
(R):5'- acttacttaacttaatgctcaaggac -3'
Posted On2014-03-14