Incidental Mutation 'R1397:Trim42'
ID160189
Institutional Source Beutler Lab
Gene Symbol Trim42
Ensembl Gene ENSMUSG00000032451
Gene Nametripartite motif-containing 42
Synonyms
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location97349562-97369958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97365621 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 341 (I341F)
Ref Sequence ENSEMBL: ENSMUSP00000035026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035026]
Predicted Effect probably damaging
Transcript: ENSMUST00000035026
AA Change: I341F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035026
Gene: ENSMUSG00000032451
AA Change: I341F

DomainStartEndE-ValueType
RING 146 191 3.67e-3 SMART
BBOX 233 280 1.42e0 SMART
BBOX 285 326 1.04e-2 SMART
low complexity region 386 399 N/A INTRINSIC
FN3 603 688 2.44e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127307
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, namely a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Trim42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02289:Trim42 APN 9 97359233 missense probably damaging 0.97
IGL02987:Trim42 APN 9 97365815 missense probably benign 0.28
R0116:Trim42 UTSW 9 97363403 missense possibly damaging 0.89
R0791:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R1170:Trim42 UTSW 9 97363620 missense probably benign 0.04
R1499:Trim42 UTSW 9 97366085 missense possibly damaging 0.95
R1522:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R2094:Trim42 UTSW 9 97366097 missense probably benign 0.23
R2355:Trim42 UTSW 9 97359240 missense probably damaging 1.00
R4621:Trim42 UTSW 9 97363148 missense probably benign
R4649:Trim42 UTSW 9 97362945 missense probably benign 0.00
R4840:Trim42 UTSW 9 97362929 missense probably benign 0.02
R6147:Trim42 UTSW 9 97363329 missense probably benign
R7048:Trim42 UTSW 9 97363421 missense probably damaging 1.00
Z1088:Trim42 UTSW 9 97369622 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCGGGATGTGACTGGAGAAAAC -3'
(R):5'- ACCTGTGCAACGACTGTCTCAAG -3'

Sequencing Primer
(F):5'- ctcctcttatcctcaccaacc -3'
(R):5'- ATGCAGGACCACGTCTTC -3'
Posted On2014-03-14