Incidental Mutation 'R1397:Rabl3'
ID160201
Institutional Source Beutler Lab
Gene Symbol Rabl3
Ensembl Gene ENSMUSG00000022827
Gene NameRAB, member RAS oncogene family-like 3
Synonyms4930553C05Rik
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37539885-37572385 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 37539974 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023524] [ENSMUST00000023525] [ENSMUST00000130028]
Predicted Effect probably benign
Transcript: ENSMUST00000023524
SMART Domains Protein: ENSMUSP00000023524
Gene: ENSMUSG00000022827

DomainStartEndE-ValueType
Pfam:MMR_HSR1 8 128 8.5e-8 PFAM
Pfam:Roc 8 132 1.2e-16 PFAM
Pfam:Ras 8 178 7.9e-15 PFAM
Pfam:Gtr1_RagA 8 181 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023525
SMART Domains Protein: ENSMUSP00000023525
Gene: ENSMUSG00000022828

DomainStartEndE-ValueType
TFIIE 28 175 2.69e-74 SMART
low complexity region 221 233 N/A INTRINSIC
low complexity region 332 351 N/A INTRINSIC
Pfam:TFIIE-A_C 354 440 9.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128036
Predicted Effect probably benign
Transcript: ENSMUST00000130028
SMART Domains Protein: ENSMUSP00000122441
Gene: ENSMUSG00000022827

DomainStartEndE-ValueType
Pfam:Arf 1 126 3.3e-6 PFAM
Pfam:Gtr1_RagA 8 118 5.5e-8 PFAM
Pfam:MMR_HSR1 8 127 9.8e-8 PFAM
Pfam:Ras 8 128 9.5e-15 PFAM
Pfam:Miro 8 129 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130350
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Rabl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Rabl3 APN 16 37541925 missense probably damaging 1.00
xiamen UTSW 16 37541931 missense probably null 1.00
R1990:Rabl3 UTSW 16 37563717 missense probably benign
R2125:Rabl3 UTSW 16 37556813 splice site probably null
R2357:Rabl3 UTSW 16 37541931 missense probably null 1.00
R4945:Rabl3 UTSW 16 37541858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGCTCGAACACTCCCACTAC -3'
(R):5'- TCGACAAAAGGAGCAAAGTCCTCTG -3'

Sequencing Primer
(F):5'- GGACGAACGCCTAATTCCTG -3'
(R):5'- CAAAGTCCTCTGGGAAGTGTAG -3'
Posted On2014-03-14