Incidental Mutation 'R1397:Abca17'
ID160203
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24285759 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1222 (E1222G)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: E1222G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: E1222G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: E1222G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: E1222G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGATGGTGGCACATGCCTACAA -3'
(R):5'- ACCAGGAGTCAGGAACCCACAG -3'

Sequencing Primer
(F):5'- tgtggtggtggtggtgg -3'
(R):5'- AGGAACCCACAGTGTGGTC -3'
Posted On2014-03-14