Incidental Mutation 'R1397:Tnks2'
ID160207
Institutional Source Beutler Lab
Gene Symbol Tnks2
Ensembl Gene ENSMUSG00000024811
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location36834232-36893477 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 36880501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025729] [ENSMUST00000164665]
Predicted Effect probably benign
Transcript: ENSMUST00000025729
SMART Domains Protein: ENSMUSP00000025729
Gene: ENSMUSG00000024811

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ANK 57 86 8.07e-5 SMART
ANK 90 119 1.78e-6 SMART
ANK 123 152 6.46e-4 SMART
ANK 210 239 1.76e-5 SMART
ANK 243 272 3.91e-3 SMART
ANK 276 305 3.23e-4 SMART
ANK 363 395 1.57e-2 SMART
ANK 399 428 4.5e-3 SMART
ANK 432 461 4.89e-4 SMART
ANK 525 554 1.43e-5 SMART
ANK 558 587 6.55e-5 SMART
ANK 591 620 1.24e-5 SMART
low complexity region 641 659 N/A INTRINSIC
ANK 678 707 1.69e-7 SMART
ANK 711 740 3.65e-3 SMART
ANK 744 773 3.36e-2 SMART
low complexity region 822 863 N/A INTRINSIC
SAM 870 936 1.03e-10 SMART
Pfam:PARP 952 1157 4.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164665
SMART Domains Protein: ENSMUSP00000132440
Gene: ENSMUSG00000024811

DomainStartEndE-ValueType
ANK 3 32 6.55e-5 SMART
ANK 36 65 1.24e-5 SMART
low complexity region 86 104 N/A INTRINSIC
ANK 123 152 1.69e-7 SMART
ANK 156 185 9.05e2 SMART
low complexity region 204 245 N/A INTRINSIC
SAM 252 318 1.03e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168654
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable but display decreased body weight and abnormal adipocyte glucose uptake in response to insulin stimulation. Mice homozygous for a different null allele show partial postnatal lethality as well as decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Tnks2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Tnks2 APN 19 36871633 missense probably benign 0.00
IGL01977:Tnks2 APN 19 36872590 critical splice donor site probably null
IGL02389:Tnks2 APN 19 36884103 missense probably benign 0.32
IGL02653:Tnks2 APN 19 36872451 missense probably damaging 1.00
IGL02678:Tnks2 APN 19 36845743 missense possibly damaging 0.63
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0426:Tnks2 UTSW 19 36852821 missense probably damaging 1.00
R0436:Tnks2 UTSW 19 36849358 missense possibly damaging 0.51
R0591:Tnks2 UTSW 19 36872562 missense probably damaging 0.99
R0648:Tnks2 UTSW 19 36862074 splice site probably null
R0894:Tnks2 UTSW 19 36890050 critical splice donor site probably null
R1459:Tnks2 UTSW 19 36845531 splice site probably benign
R1674:Tnks2 UTSW 19 36871622 missense probably benign 0.03
R1742:Tnks2 UTSW 19 36876261 missense probably damaging 1.00
R1928:Tnks2 UTSW 19 36845668 nonsense probably null
R2025:Tnks2 UTSW 19 36866066 missense probably damaging 0.99
R2898:Tnks2 UTSW 19 36872590 critical splice donor site probably null
R4422:Tnks2 UTSW 19 36845653 missense probably damaging 1.00
R4676:Tnks2 UTSW 19 36875271 nonsense probably null
R5202:Tnks2 UTSW 19 36888852 missense probably damaging 1.00
R5357:Tnks2 UTSW 19 36849290 splice site silent
R5467:Tnks2 UTSW 19 36881776 missense probably damaging 1.00
R5550:Tnks2 UTSW 19 36862346 missense probably damaging 1.00
R6119:Tnks2 UTSW 19 36879352 missense possibly damaging 0.79
R6219:Tnks2 UTSW 19 36866204 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGAGCATGATAGCACACCACG -3'
(R):5'- ACAGTACACATAGCATCCAGGAGGC -3'

Sequencing Primer
(F):5'- CGTGTACAgtgggtttcttaatttg -3'
(R):5'- ACAATTTCCCAATAGCTTAGAAGG -3'
Posted On2014-03-14