Incidental Mutation 'R1398:Lepr'
ID160220
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101792019 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 872 (D872E)
Ref Sequence ENSEMBL: ENSMUSP00000102534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
Predicted Effect probably damaging
Transcript: ENSMUST00000037552
AA Change: D872E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: D872E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102777
AA Change: D872E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: D872E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106921
AA Change: D872E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: D872E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151733
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AAATGTGGGTTTGGCCCTACTGAC -3'
(R):5'- TTTAAATGCTGCAAGTGGCACCTTC -3'

Sequencing Primer
(F):5'- TACTGACCTGATCCAGCCG -3'
(R):5'- TGCATCCTGAAGTCAGACTG -3'
Posted On2014-03-14