Incidental Mutation 'R1398:Hoxa13'
ID160229
Institutional Source Beutler Lab
Gene Symbol Hoxa13
Ensembl Gene ENSMUSG00000038203
Gene Namehomeobox A13
SynonymsHox-1.10
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1398 (G1)
Quality Score88.1
Status Not validated
Chromosome6
Chromosomal Location52257694-52260880 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) C to G at 52260647 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047993] [ENSMUST00000114416] [ENSMUST00000147595]
Predicted Effect unknown
Transcript: ENSMUST00000047993
AA Change: R43P
SMART Domains Protein: ENSMUSP00000039170
Gene: ENSMUSG00000038203
AA Change: R43P

DomainStartEndE-ValueType
low complexity region 37 81 N/A INTRINSIC
Pfam:HoxA13_N 136 219 6.2e-25 PFAM
HOX 317 379 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114416
SMART Domains Protein: ENSMUSP00000110059
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 55 1e-19 PFAM
HOX 153 215 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141300
Predicted Effect probably benign
Transcript: ENSMUST00000147595
SMART Domains Protein: ENSMUSP00000125221
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 39 8.3e-11 PFAM
HOX 137 199 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192253
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit agenesis of both the urinary bladder and the caudal portion of the Mullerian ducts, premature stenosis of the umbilical arteries, loss of the most anterior digit of all feet, and death around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Hoxa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8786:Hoxa13 UTSW 6 52260636 frame shift probably null
PIT4131001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4131001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R0458:Hoxa13 UTSW 6 52260635 frame shift probably null
R0496:Hoxa13 UTSW 6 52260635 frame shift probably null
R0502:Hoxa13 UTSW 6 52260635 frame shift probably null
R0512:Hoxa13 UTSW 6 52260635 frame shift probably null
R0784:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R1062:Hoxa13 UTSW 6 52260635 frame shift probably null
R1157:Hoxa13 UTSW 6 52260635 frame shift probably null
R1192:Hoxa13 UTSW 6 52260635 frame shift probably null
R1310:Hoxa13 UTSW 6 52260635 frame shift probably null
R1341:Hoxa13 UTSW 6 52260635 frame shift probably null
R1343:Hoxa13 UTSW 6 52260635 frame shift probably null
R1398:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1632:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R2382:Hoxa13 UTSW 6 52259145 missense probably damaging 0.98
R3149:Hoxa13 UTSW 6 52260304 intron probably benign
R4012:Hoxa13 UTSW 6 52259127 missense possibly damaging 0.47
R4426:Hoxa13 UTSW 6 52260729 utr 5 prime probably benign
R5535:Hoxa13 UTSW 6 52260540 frame shift probably null
R6175:Hoxa13 UTSW 6 52259928 missense probably damaging 0.98
R7365:Hoxa13 UTSW 6 52259882 missense probably damaging 1.00
X0018:Hoxa13 UTSW 6 52260119 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCGTAGCCCTGATGGTAGAAAGC -3'
(R):5'- TAAAACAGCGCCACTGGGGTCTTC -3'

Sequencing Primer
(F):5'- TGCCGAAGTAGCCGTAGG -3'
(R):5'- ACTGGGGTCTTCTCCATGC -3'
Posted On2014-03-14