Incidental Mutation 'R1398:Dpy19l2'
ID160238
Institutional Source Beutler Lab
Gene Symbol Dpy19l2
Ensembl Gene ENSMUSG00000085576
Gene Namedpy-19-like 2 (C. elegans)
Synonyms
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24557047-24696293 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 24581263 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133010]
Predicted Effect probably benign
Transcript: ENSMUST00000133010
SMART Domains Protein: ENSMUSP00000132092
Gene: ENSMUSG00000085576

DomainStartEndE-ValueType
Pfam:Dpy19 129 772 3.1e-233 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dpy-19 family. It is highly expressed in testis, and is required for sperm head elongation and acrosome formation during spermatogenesis. Mutations in this gene are associated with an infertility disorder, spermatogenic failure type 9 (SPGF9). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility associated with globozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Dpy19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Dpy19l2 APN 9 24582818 missense probably damaging 1.00
IGL01137:Dpy19l2 APN 9 24658562 missense possibly damaging 0.78
IGL01586:Dpy19l2 APN 9 24666975 missense probably benign 0.16
IGL02245:Dpy19l2 APN 9 24696025 missense probably benign
IGL02507:Dpy19l2 APN 9 24631267 missense probably benign 0.01
IGL02541:Dpy19l2 APN 9 24658647 missense probably benign 0.00
IGL02644:Dpy19l2 APN 9 24658592 missense probably damaging 1.00
IGL03144:Dpy19l2 APN 9 24646307 missense possibly damaging 0.92
R0022:Dpy19l2 UTSW 9 24696124 missense probably benign
R0029:Dpy19l2 UTSW 9 24558101 missense probably damaging 0.97
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0089:Dpy19l2 UTSW 9 24695793 missense probably benign 0.01
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0349:Dpy19l2 UTSW 9 24695922 missense possibly damaging 0.89
R0491:Dpy19l2 UTSW 9 24696028 missense probably benign 0.09
R0519:Dpy19l2 UTSW 9 24558095 missense probably benign 0.30
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1576:Dpy19l2 UTSW 9 24584502 missense probably benign
R1606:Dpy19l2 UTSW 9 24581215 missense probably benign
R2157:Dpy19l2 UTSW 9 24584632 missense probably benign 0.00
R2157:Dpy19l2 UTSW 9 24680780 missense probably benign 0.02
R2402:Dpy19l2 UTSW 9 24581248 missense probably damaging 1.00
R2409:Dpy19l2 UTSW 9 24658628 missense probably benign 0.00
R3196:Dpy19l2 UTSW 9 24695989 missense probably damaging 1.00
R3419:Dpy19l2 UTSW 9 24581205 missense probably damaging 1.00
R4884:Dpy19l2 UTSW 9 24628180 nonsense probably null
R5289:Dpy19l2 UTSW 9 24695997 missense probably benign
R5950:Dpy19l2 UTSW 9 24581134 missense probably benign 0.10
R6470:Dpy19l2 UTSW 9 24660743 missense possibly damaging 0.91
R7028:Dpy19l2 UTSW 9 24628251 missense probably benign 0.15
R7051:Dpy19l2 UTSW 9 24584493 missense probably benign 0.00
R7095:Dpy19l2 UTSW 9 24695814 missense probably benign 0.41
X0067:Dpy19l2 UTSW 9 24585537 missense probably benign 0.00
Z1088:Dpy19l2 UTSW 9 24660824 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCAGCCCTGTGTCAGTACAGAATG -3'
(R):5'- TGTCACAAGCCTCAGCTTCTACAAG -3'

Sequencing Primer
(F):5'- TCAGTACAGAATGGAGGCATTTG -3'
(R):5'- ATGAAGCGAGTTATCATCTGGC -3'
Posted On2014-03-14