Incidental Mutation 'R1398:Ncam1'
ID160240
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 49517589 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000193547]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068730
Predicted Effect probably benign
Transcript: ENSMUST00000114476
SMART Domains Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
low complexity region 711 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166811
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193547
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216483
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCCACTCTCTCAGTGACAG -3'
(R):5'- TGACCCGGTCTATGATGTTGATAGAGC -3'

Sequencing Primer
(F):5'- gtgtgtgtgtctgtgtgtg -3'
(R):5'- ATGTGTCTCCTGTCACACTTGTC -3'
Posted On2014-03-14