Incidental Mutation 'R1398:Gm3159'
ID160256
Institutional Source Beutler Lab
Gene Symbol Gm3159
Ensembl Gene ENSMUSG00000095056
Gene Namepredicted gene 3159
Synonyms
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1398 (G1)
Quality Score121
Status Validated
Chromosome14
Chromosomal Location4397526-4406347 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4398586 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 92 (Y92*)
Ref Sequence ENSEMBL: ENSMUSP00000137464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164038] [ENSMUST00000167245] [ENSMUST00000177764]
Predicted Effect probably null
Transcript: ENSMUST00000164038
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000126043
Gene: ENSMUSG00000095056
AA Change: Y92*

DomainStartEndE-ValueType
Pfam:Takusan 46 129 1.3e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167245
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000133201
Gene: ENSMUSG00000095056
AA Change: Y92*

DomainStartEndE-ValueType
Pfam:Takusan 48 128 5.1e-21 PFAM
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177764
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000137464
Gene: ENSMUSG00000095056
AA Change: Y92*

DomainStartEndE-ValueType
Pfam:Takusan 46 129 5.6e-30 PFAM
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Gm3159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02960:Gm3159 APN 14 4400552 critical splice donor site probably null
R4477:Gm3159 UTSW 14 4398584 missense probably damaging 1.00
R4479:Gm3159 UTSW 14 4398584 missense probably damaging 1.00
R4480:Gm3159 UTSW 14 4398584 missense probably damaging 1.00
R5677:Gm3159 UTSW 14 4398582 missense probably damaging 0.97
R6957:Gm3159 UTSW 14 4398530 missense possibly damaging 0.94
R7366:Gm3159 UTSW 14 4398525 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CCCTGGGCCATCAAGTATGCAAAC -3'
(R):5'- GCAACAAGTGTGAGCAGGTCCTTC -3'

Sequencing Primer
(F):5'- AGTATGCAAACTCATTTGTGTTTATC -3'
(R):5'- ATTGCAAGCATCCCAGGGTC -3'
Posted On2014-03-14