Incidental Mutation 'R1398:C4b'
ID160270
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 34730719 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGTGACTCACGTAACGGTCAG -3'
(R):5'- ACTACTATGACATGCCAGCCGCAG -3'

Sequencing Primer
(F):5'- CAGGGACCCTGGTCATTGTG -3'
(R):5'- ATGCCAGCCGCAGATGAC -3'
Posted On2014-03-14