Incidental Mutation 'R1398:Kctd1'
ID160273
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Namepotassium channel tetramerisation domain containing 1
Synonyms
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1398 (G1)
Quality Score132
Status Validated
Chromosome18
Chromosomal Location14968685-15151446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15062597 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 323 (E323G)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
Predicted Effect probably benign
Transcript: ENSMUST00000025992
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168989
AA Change: E323G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: E323G

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15062690 missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01404:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15062637 missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15062880 missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 14969610 missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 14973979 critical splice donor site probably null
R0128:Kctd1 UTSW 18 14974180 missense probably benign 0.00
R0598:Kctd1 UTSW 18 15007765 missense probably damaging 1.00
R1669:Kctd1 UTSW 18 15062460 missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 14969560 missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15063206 intron probably benign
R1779:Kctd1 UTSW 18 15061782 missense probably benign 0.01
R2083:Kctd1 UTSW 18 14974055 missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15062211 missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 14974086 missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15007700 missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15063227 intron probably benign
R4884:Kctd1 UTSW 18 14974254 missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15062523 missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15062765 missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15062265 missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15063516 intron probably benign
R5893:Kctd1 UTSW 18 14969688 missense possibly damaging 0.93
R6175:Kctd1 UTSW 18 14969631 nonsense probably null
R6767:Kctd1 UTSW 18 15062175 missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 14986344 missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 14973988 missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15062643 missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15062412 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGACCCGTTCAGAGAGTCGGTATAG -3'
(R):5'- TGGTGCAGAAGCAAGCCATCAC -3'

Sequencing Primer
(F):5'- ATACCCGCGATGCTGTTGAG -3'
(R):5'- CTCAACAAGGTCTGGTTCGA -3'
Posted On2014-03-14