Incidental Mutation 'R1399:Vmn2r121'
ID160299
Institutional Source Beutler Lab
Gene Symbol Vmn2r121
Ensembl Gene ENSMUSG00000072049
Gene Namevomeronasal 2, receptor 121
SynonymsEG625699
MMRRC Submission 039461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1399 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location124127339-124135910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 124129848 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 541 (V541G)
Ref Sequence ENSEMBL: ENSMUSP00000092067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094491
AA Change: V541G

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092067
Gene: ENSMUSG00000072049
AA Change: V541G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 448 3.2e-26 PFAM
Pfam:NCD3G 506 560 2.1e-19 PFAM
Pfam:7tm_3 593 828 3.8e-56 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 T C 10: 80,341,208 S469G probably damaging Het
Cep170 C T 1: 176,758,403 E608K probably damaging Het
Csnk1g3 T C 18: 53,895,910 V45A probably damaging Het
DXBay18 A G X: 73,138,629 L287P probably damaging Het
Eng C A 2: 32,673,322 Q297K probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
G6pd2 G A 5: 61,810,018 D379N probably benign Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Gm8251 G A 1: 44,061,311 T209I possibly damaging Het
Mrc1 C T 2: 14,279,925 T575M probably damaging Het
Noct C T 3: 51,250,476 probably null Het
Phka1 A G X: 102,617,358 S226P probably damaging Het
Pias4 T C 10: 81,155,675 Y346C probably damaging Het
Ptger4 C T 15: 5,234,931 E415K possibly damaging Het
Rb1cc1 G A 1: 6,249,818 V1154I probably benign Het
Zfp92 A T X: 73,422,795 T465S probably benign Het
Zfp92 A G X: 73,422,130 H243R probably damaging Het
Other mutations in Vmn2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r121 APN X 124127802 missense probably benign 0.04
IGL00990:Vmn2r121 APN X 124127783 missense possibly damaging 0.95
IGL00990:Vmn2r121 APN X 124133716 missense probably benign 0.00
IGL01125:Vmn2r121 APN X 124132807 missense probably damaging 0.99
IGL01450:Vmn2r121 APN X 124131191 missense possibly damaging 0.57
IGL01619:Vmn2r121 APN X 124132300 missense probably benign
IGL01797:Vmn2r121 APN X 124131351 splice site probably benign
IGL02227:Vmn2r121 APN X 124132681 missense probably benign 0.44
IGL02971:Vmn2r121 APN X 124127894 missense probably damaging 1.00
IGL03058:Vmn2r121 APN X 124132921 missense probably benign 0.00
IGL03142:Vmn2r121 APN X 124132938 missense possibly damaging 0.94
IGL03183:Vmn2r121 APN X 124132326 missense probably benign 0.03
E0370:Vmn2r121 UTSW X 124127920 missense probably benign 0.01
R0196:Vmn2r121 UTSW X 124132182 missense probably benign 0.03
R1381:Vmn2r121 UTSW X 124128140 missense probably damaging 1.00
R1423:Vmn2r121 UTSW X 124129905 missense possibly damaging 0.52
R1687:Vmn2r121 UTSW X 124132791 missense probably benign 0.39
R2121:Vmn2r121 UTSW X 124133742 splice site probably null
R2124:Vmn2r121 UTSW X 124133742 splice site probably null
R3151:Vmn2r121 UTSW X 124131152 missense probably benign 0.20
R4460:Vmn2r121 UTSW X 124128584 missense probably benign 0.01
R4735:Vmn2r121 UTSW X 124128638 missense probably benign
R5332:Vmn2r121 UTSW X 124133575 missense probably benign
R6102:Vmn2r121 UTSW X 124133575 missense probably benign
X0023:Vmn2r121 UTSW X 124135657 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTTGCTGCATTCTTCAAAACTTCACTCT -3'
(R):5'- GAAAAGCAGGTGTCACACAAATGTTCTT -3'

Sequencing Primer
(F):5'- CAAGTGTTACCCTGAGTATCTAGTC -3'
(R):5'- AACTGCTACAACCTGAATGTTAC -3'
Posted On2014-03-14