Incidental Mutation 'R1400:Ndst3'
ID160309
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R1400 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123556828 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 636 (F636S)
Ref Sequence ENSEMBL: ENSMUSP00000133657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000124803] [ENSMUST00000132112] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably damaging
Transcript: ENSMUST00000029602
AA Change: F636S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: F636S

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124803
AA Change: F221S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122617
Gene: ENSMUSG00000027977
AA Change: F221S

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132112
AA Change: F221S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120623
Gene: ENSMUSG00000027977
AA Change: F221S

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132896
Predicted Effect probably benign
Transcript: ENSMUST00000137404
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154668
AA Change: F636S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: F636S

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172537
AA Change: F636S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: F636S

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199825
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCCCTCCTATTAACTGGAGAGCC -3'
(R):5'- GGGAGTACACTGAAAGAACCTGCC -3'

Sequencing Primer
(F):5'- CCTATTAACTGGAGAGCCTTGGTATG -3'
(R):5'- TGAAAGAACCTGCCTCACTC -3'
Posted On2014-03-14