Incidental Mutation 'R1400:Olfr847'
ID160332
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Nameolfactory receptor 847
SynonymsMOR149-2, GA_x6K02T2PVTD-13113073-13112135
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1400 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19373668-19378669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19375062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 273 (V273A)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
Predicted Effect probably damaging
Transcript: ENSMUST00000079620
AA Change: V273A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: V273A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212306
AA Change: V273A
Predicted Effect probably damaging
Transcript: ENSMUST00000216839
AA Change: V273A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R2894:Olfr847 UTSW 9 19375292 nonsense probably null
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5517:Olfr847 UTSW 9 19375767 missense probably damaging 1.00
R5599:Olfr847 UTSW 9 19375629 missense possibly damaging 0.77
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R6509:Olfr847 UTSW 9 19375143 missense probably benign
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGAACCTGACTTTGAACCAACACAT -3'
(R):5'- GCTTGCCTGTTCTGATACTCTCATCAAT -3'

Sequencing Primer
(F):5'- GGAAAACTCAAACATGCTTACTCATC -3'
(R):5'- GAATTCCAATCTCTGGAATCATTTTC -3'
Posted On2014-03-14