Incidental Mutation 'R1400:Atr'
ID160334
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Nameataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1400 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95857597-95951781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95862848 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 73 (Q73K)
Ref Sequence ENSEMBL: ENSMUSP00000149953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
Predicted Effect probably benign
Transcript: ENSMUST00000034980
AA Change: Q73K

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: Q73K

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178038
SMART Domains Protein: ENSMUSP00000136667
Gene: ENSMUSG00000096655

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 146 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191269
Predicted Effect probably benign
Transcript: ENSMUST00000215311
AA Change: Q73K

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95865052 missense probably damaging 1.00
IGL00922:Atr APN 9 95907345 missense probably damaging 0.97
IGL01020:Atr APN 9 95862783 missense probably damaging 1.00
IGL01345:Atr APN 9 95940949 missense probably damaging 1.00
IGL01364:Atr APN 9 95865624 missense probably benign 0.29
IGL01456:Atr APN 9 95950565 missense possibly damaging 0.62
IGL01534:Atr APN 9 95865546 missense probably damaging 0.99
IGL01761:Atr APN 9 95951448 splice site probably benign
IGL01791:Atr APN 9 95921781 missense probably benign 0.05
IGL01831:Atr APN 9 95870754 missense probably benign 0.18
IGL01973:Atr APN 9 95871674 missense probably damaging 1.00
IGL02008:Atr APN 9 95881420 splice site probably benign
IGL02016:Atr APN 9 95927175 missense probably benign 0.09
IGL02035:Atr APN 9 95866682 missense probably benign 0.01
IGL02058:Atr APN 9 95871487 missense probably damaging 0.99
IGL02081:Atr APN 9 95883205 missense probably damaging 1.00
IGL02224:Atr APN 9 95878629 missense probably damaging 0.98
IGL02234:Atr APN 9 95947250 splice site probably benign
IGL02367:Atr APN 9 95899141 nonsense probably null
IGL02621:Atr APN 9 95908400 missense probably benign 0.00
IGL02728:Atr APN 9 95936475 missense probably damaging 1.00
IGL02833:Atr APN 9 95862852 missense probably damaging 1.00
IGL02939:Atr APN 9 95865261 missense probably benign
IGL03107:Atr APN 9 95897730 missense probably benign 0.28
IGL03382:Atr APN 9 95920822 nonsense probably null
R0042:Atr UTSW 9 95927356 splice site probably benign
R0042:Atr UTSW 9 95927356 splice site probably benign
R0281:Atr UTSW 9 95937566 missense probably benign 0.26
R0282:Atr UTSW 9 95862798 missense probably benign 0.12
R0512:Atr UTSW 9 95935526 missense probably damaging 0.99
R0547:Atr UTSW 9 95899165 splice site probably benign
R0567:Atr UTSW 9 95865829 missense probably benign 0.00
R0631:Atr UTSW 9 95874777 missense possibly damaging 0.92
R1116:Atr UTSW 9 95867636 nonsense probably null
R1171:Atr UTSW 9 95907323 missense probably damaging 1.00
R1241:Atr UTSW 9 95950636 missense probably benign 0.08
R1345:Atr UTSW 9 95920355 missense probably benign 0.25
R1413:Atr UTSW 9 95932442 missense probably damaging 1.00
R1527:Atr UTSW 9 95870043 missense possibly damaging 0.82
R1557:Atr UTSW 9 95871449 missense probably damaging 1.00
R1591:Atr UTSW 9 95945385 missense probably damaging 1.00
R1602:Atr UTSW 9 95951557 missense probably damaging 1.00
R1605:Atr UTSW 9 95936463 missense probably damaging 1.00
R1670:Atr UTSW 9 95861456 missense probably benign 0.38
R1709:Atr UTSW 9 95871076 missense probably benign 0.00
R1728:Atr UTSW 9 95897581 missense probably benign 0.01
R1729:Atr UTSW 9 95897581 missense probably benign 0.01
R1739:Atr UTSW 9 95897581 missense probably benign 0.01
R1816:Atr UTSW 9 95866694 missense probably benign 0.00
R1824:Atr UTSW 9 95936421 missense probably damaging 1.00
R1844:Atr UTSW 9 95905817 missense probably benign 0.01
R1857:Atr UTSW 9 95865097 missense probably damaging 1.00
R1858:Atr UTSW 9 95865097 missense probably damaging 1.00
R1866:Atr UTSW 9 95870605 splice site probably null
R1913:Atr UTSW 9 95866733 missense probably benign 0.01
R2042:Atr UTSW 9 95870022 missense probably benign 0.00
R2210:Atr UTSW 9 95907300 missense probably damaging 1.00
R2230:Atr UTSW 9 95920765 missense probably damaging 1.00
R2361:Atr UTSW 9 95871157 missense probably benign 0.41
R2399:Atr UTSW 9 95871599 missense probably benign 0.00
R2431:Atr UTSW 9 95862892 missense probably benign 0.24
R2860:Atr UTSW 9 95874243 missense probably benign 0.07
R2861:Atr UTSW 9 95874243 missense probably benign 0.07
R3019:Atr UTSW 9 95905818 missense possibly damaging 0.52
R3684:Atr UTSW 9 95920400 missense probably damaging 0.96
R4155:Atr UTSW 9 95888124 nonsense probably null
R4295:Atr UTSW 9 95874426 missense probably benign 0.04
R4359:Atr UTSW 9 95951536 missense probably damaging 1.00
R4506:Atr UTSW 9 95865237 missense probably benign 0.21
R4523:Atr UTSW 9 95862863 missense probably damaging 1.00
R4536:Atr UTSW 9 95874418 missense probably benign 0.26
R4588:Atr UTSW 9 95865667 missense probably benign
R4646:Atr UTSW 9 95871197 critical splice donor site probably null
R4702:Atr UTSW 9 95920355 missense possibly damaging 0.92
R4743:Atr UTSW 9 95862792 missense probably benign 0.14
R4782:Atr UTSW 9 95862797 missense probably benign 0.00
R4928:Atr UTSW 9 95907299 missense probably damaging 1.00
R5031:Atr UTSW 9 95865702 missense probably damaging 0.98
R5138:Atr UTSW 9 95937596 missense probably benign 0.15
R5188:Atr UTSW 9 95921725 missense probably benign 0.00
R5219:Atr UTSW 9 95881238 missense probably damaging 0.99
R5307:Atr UTSW 9 95878544 missense probably benign 0.01
R5414:Atr UTSW 9 95870704 missense probably benign 0.00
R5628:Atr UTSW 9 95874226 nonsense probably null
R5664:Atr UTSW 9 95905813 missense probably benign 0.00
R5678:Atr UTSW 9 95951487 nonsense probably null
R5724:Atr UTSW 9 95866588 missense probably damaging 1.00
R5759:Atr UTSW 9 95874402 missense probably benign 0.01
R5763:Atr UTSW 9 95945123 missense probably benign 0.04
R5922:Atr UTSW 9 95903682 missense probably benign 0.00
R6051:Atr UTSW 9 95908369 missense possibly damaging 0.85
R6161:Atr UTSW 9 95865319 missense probably benign
R6171:Atr UTSW 9 95881271 nonsense probably null
R6532:Atr UTSW 9 95908408 missense probably benign
R6774:Atr UTSW 9 95927213 missense probably benign 0.00
R6894:Atr UTSW 9 95927197 missense probably damaging 1.00
R6930:Atr UTSW 9 95866635 missense probably benign 0.21
R7018:Atr UTSW 9 95866694 missense probably benign 0.17
R7056:Atr UTSW 9 95862863 missense probably damaging 1.00
R7103:Atr UTSW 9 95865372 missense not run
X0019:Atr UTSW 9 95940871 missense probably damaging 1.00
Z1088:Atr UTSW 9 95885320 intron probably null
Predicted Primers PCR Primer
(F):5'- GCACACCTGTGATTGCTGCAATTC -3'
(R):5'- CCAAAAGCAAATATGACTTGTGGGAGC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GCAAAGGAGATCTAATAAAACTGGT -3'
Posted On2014-03-14