Incidental Mutation 'R1400:Gcgr'
ID160339
Institutional Source Beutler Lab
Gene Symbol Gcgr
Ensembl Gene ENSMUSG00000025127
Gene Nameglucagon receptor
SynonymsGR
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1400 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120530699-120538986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120534986 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 45 (H45R)
Ref Sequence ENSEMBL: ENSMUSP00000026119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026119]
Predicted Effect probably benign
Transcript: ENSMUST00000026119
AA Change: H45R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026119
Gene: ENSMUSG00000025127
AA Change: H45R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
HormR 55 131 4.94e-27 SMART
Pfam:7tm_2 139 397 6.4e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148579
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glucagon receptor that is important in controlling blood glucose levels. Defects in this gene are a cause of non-insulin-dependent diabetes mellitus (NIDDM).[provided by RefSeq, Jan 2010]
PHENOTYPE: Animals homozygous for a targeted mutation in this gene exhibit reduced blood glucose levels and increased plasma glucagon and amino acid levels associated with alpha-cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Gcgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02286:Gcgr APN 11 120537931 missense probably damaging 1.00
IGL02406:Gcgr APN 11 120537184 missense probably damaging 0.99
IGL02756:Gcgr APN 11 120536985 missense probably benign 0.03
IGL02942:Gcgr APN 11 120536817 splice site probably null
R0519:Gcgr UTSW 11 120536156 missense probably damaging 1.00
R0549:Gcgr UTSW 11 120536561 missense probably benign 0.28
R4272:Gcgr UTSW 11 120538424 unclassified probably benign
R5155:Gcgr UTSW 11 120537046 missense probably benign 0.30
R6042:Gcgr UTSW 11 120534758 start codon destroyed probably null 0.02
R6093:Gcgr UTSW 11 120538121 missense probably damaging 1.00
R6867:Gcgr UTSW 11 120536469 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CCCCATGTAGCGGGAAAACAGTAG -3'
(R):5'- AGTGGCTGGGCATTATAAAGCCATC -3'

Sequencing Primer
(F):5'- CTCTGAATAGGCACTGTGAGC -3'
(R):5'- CTGGGCATTATAAAGCCATCCTTAC -3'
Posted On2014-03-14