Mutagenetix > Incidental Mutation

Incidental Mutation 'R1400:Rasgrf2'

160346

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

039462-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R1400 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92028519-92268164 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92035808 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1077 (L1077P)

Ref Sequence

ENSEMBL: ENSMUSP00000096930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

AlphaFold

P70392

Predicted Effect

probably damaging
Transcript: ENSMUST00000099326
AA Change: L1077P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: L1077P

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000151408
AA Change: L476P

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: L476P

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130008F23Rik	T	C	17: 41,191,195 (GRCm39)	E78G	probably damaging	Het
Acsf2	T	C	11: 94,461,142 (GRCm39)	I345V	probably benign	Het
Akap11	T	A	14: 78,751,402 (GRCm39)	K328N	probably damaging	Het
Aoc1	T	A	6: 48,883,217 (GRCm39)	Y364*	probably null	Het
Aoc1	A	T	6: 48,883,645 (GRCm39)	Q507L	probably benign	Het
Atp6v1c2	T	C	12: 17,339,131 (GRCm39)	T207A	probably benign	Het
Atr	C	A	9: 95,744,901 (GRCm39)	Q73K	probably benign	Het
Cage1	A	G	13: 38,216,400 (GRCm39)	S17P	possibly damaging	Het
Cfap44	A	T	16: 44,241,575 (GRCm39)	I649F	probably benign	Het
Cops4	A	G	5: 100,681,412 (GRCm39)	K200R	probably damaging	Het
Crygd	A	G	1: 65,102,367 (GRCm39)	S32P	probably damaging	Het
Cyp3a11	A	G	5: 145,799,299 (GRCm39)	I296T	probably damaging	Het
Fads3	A	G	19: 10,033,664 (GRCm39)		probably null	Het
Fbn2	T	C	18: 58,213,265 (GRCm39)	E974G	possibly damaging	Het
Gcgr	A	G	11: 120,425,812 (GRCm39)	H45R	probably benign	Het
Gcn1	T	C	5: 115,752,220 (GRCm39)	I2112T	probably damaging	Het
Gm43302	A	T	5: 105,422,622 (GRCm39)	I470N	probably damaging	Het
Hoxa13	C	G	6: 52,260,647 (GRCm38)		probably benign	Het
Hoxa13	G	C	6: 52,260,648 (GRCm38)		probably benign	Het
Hsh2d	G	A	8: 72,954,304 (GRCm39)	D229N	probably benign	Het
Krt13	C	A	11: 100,012,110 (GRCm39)	G71V	probably damaging	Het
Las1l	T	C	X: 94,990,506 (GRCm39)	T390A	possibly damaging	Het
Lifr	T	A	15: 7,220,346 (GRCm39)	V992E	probably benign	Het
Mbd5	T	C	2: 49,164,788 (GRCm39)		probably null	Het
Mzf1	C	A	7: 12,786,698 (GRCm39)	R124L	possibly damaging	Het
Ndst3	A	G	3: 123,350,477 (GRCm39)	F636S	probably damaging	Het
Necab1	T	C	4: 14,975,185 (GRCm39)	D232G	possibly damaging	Het
Nlrp4e	A	T	7: 23,021,085 (GRCm39)	E524V	possibly damaging	Het
Nxf3	T	A	X: 134,976,794 (GRCm39)	T349S	probably benign	Het
Ofcc1	C	T	13: 40,362,305 (GRCm39)	G206R	probably benign	Het
Or4c12	T	A	2: 89,773,886 (GRCm39)	H191L	possibly damaging	Het
Or4n5	A	T	14: 50,133,148 (GRCm39)	I37K	possibly damaging	Het
Or7g29	A	G	9: 19,286,358 (GRCm39)	V273A	probably damaging	Het
Or9g19	T	C	2: 85,600,477 (GRCm39)	C111R	possibly damaging	Het
Plscr1l1	G	T	9: 92,233,180 (GRCm39)	C25F	probably benign	Het
Ppm1e	T	A	11: 87,122,592 (GRCm39)	N455I	probably damaging	Het
Prkag2	G	A	5: 25,078,916 (GRCm39)	T158I	probably damaging	Het
Ptpn18	T	C	1: 34,502,587 (GRCm39)		probably null	Het
Rai14	T	G	15: 10,571,634 (GRCm39)	K936N	probably damaging	Het
Rgn	C	A	X: 20,416,696 (GRCm39)	Q27K	probably benign	Het
Ryr2	C	T	13: 11,609,962 (GRCm39)	S723N	probably benign	Het
Scamp1	A	G	13: 94,361,455 (GRCm39)	F142L	possibly damaging	Het
Selenon	A	G	4: 134,278,829 (GRCm39)	V67A	probably benign	Het
Slc5a5	T	C	8: 71,342,079 (GRCm39)	I292V	possibly damaging	Het
Smarca2	C	A	19: 26,654,140 (GRCm39)	T775K	probably damaging	Het
Stab1	C	T	14: 30,861,787 (GRCm39)	V2437I	possibly damaging	Het
Tas2r143	C	T	6: 42,377,317 (GRCm39)	A49V	probably benign	Het
Tlr7	T	A	X: 166,090,845 (GRCm39)	N214Y	probably damaging	Het
Unc13a	C	A	8: 72,103,865 (GRCm39)	D856Y	probably damaging	Het
Upp2	T	C	2: 58,680,118 (GRCm39)	Y263H	probably damaging	Het
Vill	T	C	9: 118,892,415 (GRCm39)	S349P	probably benign	Het
Zfp644	T	C	5: 106,785,336 (GRCm39)		probably null	Het
Zfp664	T	C	5: 124,963,217 (GRCm39)	C204R	unknown	Het
Zfp729b	A	G	13: 67,740,913 (GRCm39)	Y451H	possibly damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92,159,425 (GRCm39)	splice site	probably benign
IGL01358:Rasgrf2	APN	13	92,130,749 (GRCm39)	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92,174,718 (GRCm39)	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	92,130,857 (GRCm39)	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	92,136,145 (GRCm39)	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92,267,900 (GRCm39)	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92,167,273 (GRCm39)	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	92,131,752 (GRCm39)	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92,159,413 (GRCm39)	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	92,136,098 (GRCm39)	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	92,044,170 (GRCm39)	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	92,067,936 (GRCm39)	splice site	probably benign
R0632:Rasgrf2	UTSW	13	92,120,393 (GRCm39)	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	92,130,890 (GRCm39)	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92,165,174 (GRCm39)	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92,167,396 (GRCm39)	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	92,131,795 (GRCm39)	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	92,044,205 (GRCm39)	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	92,038,783 (GRCm39)	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	92,050,740 (GRCm39)	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	92,117,149 (GRCm39)	missense	probably benign
R1934:Rasgrf2	UTSW	13	92,131,825 (GRCm39)	splice site	probably null
R1990:Rasgrf2	UTSW	13	92,172,473 (GRCm39)	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	92,050,748 (GRCm39)	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92,167,351 (GRCm39)	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	92,120,374 (GRCm39)	missense	probably benign
R2193:Rasgrf2	UTSW	13	92,160,221 (GRCm39)	splice site	probably null
R2406:Rasgrf2	UTSW	13	92,120,359 (GRCm39)	missense	probably benign
R3055:Rasgrf2	UTSW	13	92,165,583 (GRCm39)	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92,167,296 (GRCm39)	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	92,130,773 (GRCm39)	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	92,038,717 (GRCm39)	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	92,038,717 (GRCm39)	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	92,131,797 (GRCm39)	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	92,131,797 (GRCm39)	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	92,131,797 (GRCm39)	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	92,033,773 (GRCm39)	nonsense	probably null
R4576:Rasgrf2	UTSW	13	92,044,529 (GRCm39)	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92,174,789 (GRCm39)	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	92,138,716 (GRCm39)	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	92,131,780 (GRCm39)	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	92,136,135 (GRCm39)	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92,160,190 (GRCm39)	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	92,044,155 (GRCm39)	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92,267,941 (GRCm39)	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	92,068,011 (GRCm39)	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92,165,609 (GRCm39)	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92,167,293 (GRCm39)	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92,267,954 (GRCm39)	missense	probably benign
R6428:Rasgrf2	UTSW	13	92,136,100 (GRCm39)	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92,167,361 (GRCm39)	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92,165,027 (GRCm39)	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	92,033,754 (GRCm39)	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	92,131,732 (GRCm39)	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	92,130,952 (GRCm39)	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92,159,100 (GRCm39)	intron	probably benign
R7056:Rasgrf2	UTSW	13	92,167,203 (GRCm39)	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	92,034,521 (GRCm39)	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	92,032,637 (GRCm39)	nonsense	probably null
R7392:Rasgrf2	UTSW	13	92,041,856 (GRCm39)	missense
R7469:Rasgrf2	UTSW	13	92,165,530 (GRCm39)	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	92,136,085 (GRCm39)	missense
R7641:Rasgrf2	UTSW	13	92,267,914 (GRCm39)	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92,267,914 (GRCm39)	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	92,044,201 (GRCm39)	missense
R7962:Rasgrf2	UTSW	13	92,167,300 (GRCm39)	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92,167,321 (GRCm39)	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	92,130,796 (GRCm39)	missense
R8796:Rasgrf2	UTSW	13	92,038,685 (GRCm39)	missense
R8913:Rasgrf2	UTSW	13	92,159,034 (GRCm39)	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92,158,225 (GRCm39)	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92,165,146 (GRCm39)	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92,267,759 (GRCm39)	missense	probably benign
R9562:Rasgrf2	UTSW	13	92,034,469 (GRCm39)	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	92,136,092 (GRCm39)	missense
R9766:Rasgrf2	UTSW	13	92,160,188 (GRCm39)	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92,267,860 (GRCm39)	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92,167,363 (GRCm39)	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	92,050,654 (GRCm39)	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	92,159,081 (GRCm39)	missense	unknown
Z1177:Rasgrf2	UTSW	13	92,131,632 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TTCTTCCCAGCAATGTAGGGAGCC -3'
(R):5'- CCCGCAGTAAGTCCTCATCCAATTC -3'

Sequencing Primer
(F):5'- CAATGTAGGGAGCCGGTCAC -3'
(R):5'- tgcaagatcctgagtcagatg -3'

Posted On

2014-03-14