Incidental Mutation 'R1400:Stab1'
ID160348
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Namestabilin 1
SynonymsMS-1
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1400 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31139013-31168641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31139830 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 2437 (V2437I)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000090212] [ENSMUST00000159249] [ENSMUST00000160024] [ENSMUST00000226588] [ENSMUST00000227096] [ENSMUST00000227794]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036618
AA Change: V2437I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: V2437I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090212
SMART Domains Protein: ENSMUSP00000087680
Gene: ENSMUSG00000071547

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 367 1.5e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159208
Predicted Effect probably benign
Transcript: ENSMUST00000159249
SMART Domains Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
EGF 110 147 1.26e-2 SMART
EGF 157 191 1.61e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159480
Predicted Effect possibly damaging
Transcript: ENSMUST00000160024
AA Change: V7I

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125239
Gene: ENSMUSG00000042286
AA Change: V7I

DomainStartEndE-ValueType
Blast:FAS1 1 32 5e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162763
Predicted Effect probably benign
Transcript: ENSMUST00000226588
Predicted Effect probably benign
Transcript: ENSMUST00000226975
Predicted Effect probably benign
Transcript: ENSMUST00000227096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227690
Predicted Effect probably benign
Transcript: ENSMUST00000227794
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 unclassified probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 intron probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense not run
R7145:Stab1 UTSW 14 31145073 critical splice donor site unknown
R7153:Stab1 UTSW 14 31160584 missense not run
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTGTTCCAGAAGTTACCACAACCCC -3'
(R):5'- ACCTTTCTGAGTATCAATGCCAGCC -3'

Sequencing Primer
(F):5'- CAAGCTTAATGCCACAGGTG -3'
(R):5'- CCGGGGGACATTGCTTC -3'
Posted On2014-03-14