Incidental Mutation 'R1400:Smarca2'
ID160359
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
SynonymsSnf2l2, brm, 2610209L14Rik
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1400 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location26605050-26778322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26676740 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 775 (T775K)
Ref Sequence ENSEMBL: ENSMUSP00000135017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025862
AA Change: T775K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: T775K

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099537
AA Change: T775K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: T775K

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176019
Predicted Effect possibly damaging
Transcript: ENSMUST00000176030
AA Change: T775K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: T775K

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176769
AA Change: T775K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: T775K

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208303
AA Change: T100K
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26774294 missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26698465 missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26716137 missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26672740 missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26716182 missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26640586 missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26676624 splice site probably benign
IGL03028:Smarca2 APN 19 26678312 splice site probably benign
IGL03187:Smarca2 APN 19 26672824 missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26623975 missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26619903 missense probably benign 0.01
FR4737:Smarca2 UTSW 19 26630999 unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26649093 missense probably benign 0.35
R0184:Smarca2 UTSW 19 26692249 nonsense probably null
R0306:Smarca2 UTSW 19 26640613 missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26691362 missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26681875 missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26691391 missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26706200 missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26698403 missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26770933 splice site probably benign
R1256:Smarca2 UTSW 19 26681973 missense probably benign 0.06
R1299:Smarca2 UTSW 19 26771611 critical splice donor site probably null
R1306:Smarca2 UTSW 19 26770988 missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26630828 missense probably damaging 1.00
R1415:Smarca2 UTSW 19 26710684 missense probably null 0.72
R1496:Smarca2 UTSW 19 26631101 missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26751905 missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26640380 splice site probably benign
R1861:Smarca2 UTSW 19 26623884 missense probably benign 0.03
R1962:Smarca2 UTSW 19 26672724 nonsense probably null
R1964:Smarca2 UTSW 19 26672724 nonsense probably null
R1998:Smarca2 UTSW 19 26631093 missense probably benign 0.33
R2014:Smarca2 UTSW 19 26683905 missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26771038 missense probably benign 0.01
R2392:Smarca2 UTSW 19 26640650 critical splice donor site probably null
R2439:Smarca2 UTSW 19 26691454 critical splice donor site probably null
R3030:Smarca2 UTSW 19 26752029 missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26683822 missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26668890 unclassified probably benign
R3845:Smarca2 UTSW 19 26720873 missense probably benign 0.06
R4013:Smarca2 UTSW 19 26683927 splice site probably null
R4014:Smarca2 UTSW 19 26683927 splice site probably null
R4016:Smarca2 UTSW 19 26683927 splice site probably null
R4271:Smarca2 UTSW 19 26720949 critical splice donor site probably null
R4471:Smarca2 UTSW 19 26619877 missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26776225 missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26630673 missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26654483 missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26720855 nonsense probably null
R5015:Smarca2 UTSW 19 26691388 missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26691372 missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26640429 missense probably benign 0.18
R5503:Smarca2 UTSW 19 26623936 missense probably damaging 0.96
R5503:Smarca2 UTSW 19 26682046 missense possibly damaging 0.93
R5715:Smarca2 UTSW 19 26649122 missense probably benign 0.16
R5790:Smarca2 UTSW 19 26676724 missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26776069 intron probably benign
R6209:Smarca2 UTSW 19 26771004 nonsense probably null
R6236:Smarca2 UTSW 19 26696213 missense probably benign 0.33
R6291:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26678363 missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26630931 missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26679173 missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26619884 missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26654377 missense probably benign 0.30
R6804:Smarca2 UTSW 19 26751886 missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26669155 missense possibly damaging 0.83
R7213:Smarca2 UTSW 19 26647131 missense possibly damaging 0.96
R7257:Smarca2 UTSW 19 26654464 nonsense probably null
R7259:Smarca2 UTSW 19 26654464 nonsense probably null
R7479:Smarca2 UTSW 19 26640487 missense probably benign 0.00
R7512:Smarca2 UTSW 19 26683809 missense possibly damaging 0.51
X0061:Smarca2 UTSW 19 26720840 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCACTTAGCACCTGCCAAGC -3'
(R):5'- CCCCATGCCACTATTCTGTCTGAAG -3'

Sequencing Primer
(F):5'- AACTCTGCTACTGTGGGACAC -3'
(R):5'- CCACTATTCTGTCTGAAGAAAGAAAC -3'
Posted On2014-03-14