Incidental Mutation 'R1400:Tlr7'
ID160364
Institutional Source Beutler Lab
Gene Symbol Tlr7
Ensembl Gene ENSMUSG00000044583
Gene Nametoll-like receptor 7
SynonymsRP23-139P21.3
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1400 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location167304929-167330558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167307849 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 214 (N214Y)
Ref Sequence ENSEMBL: ENSMUSP00000107789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060719] [ENSMUST00000112161] [ENSMUST00000112164] [ENSMUST00000137492] [ENSMUST00000145284]
Predicted Effect probably damaging
Transcript: ENSMUST00000060719
AA Change: N214Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061853
Gene: ENSMUSG00000044583
AA Change: N214Y

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
Pfam:LRR_7 676 692 7.2e-2 PFAM
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 4.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112161
AA Change: N214Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107787
Gene: ENSMUSG00000044583
AA Change: N214Y

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
Pfam:LRR_7 676 692 7.2e-2 PFAM
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 4.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112164
AA Change: N214Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107789
Gene: ENSMUSG00000044583
AA Change: N214Y

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 891 1049 1.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137492
Predicted Effect probably benign
Transcript: ENSMUST00000145284
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung, placenta, and spleen, and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Jul 2008]
PHENOTYPE: The innate immune response to viral infection is affected in homozygous null mice. Mice homozygous or hemizygous for a point mutation produce little or no tumor necrosis factor (TNF) alpha in response to stimulation by a single stranded RNA analog. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Tlr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Tlr7 APN X 167308475 missense possibly damaging 0.94
IGL01064:Tlr7 APN X 167308211 missense probably damaging 1.00
IGL02940:Tlr7 APN X 167307834 missense probably benign 0.02
IGL03064:Tlr7 APN X 167306207 missense possibly damaging 0.89
IGL03298:Tlr7 APN X 167306707 missense probably benign 0.45
rsq1 UTSW X 167308286 missense probably damaging 1.00
rsq2 UTSW X 167307945 missense probably damaging 0.98
rsq3 UTSW X 167307945 missense probably damaging 0.98
R1883:Tlr7 UTSW X 167306472 missense probably benign 0.20
R5929:Tlr7 UTSW X 167306882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAGGTCAAGAACTTCCAGCC -3'
(R):5'- CACAGGATCTGCCATCCAGCTTAC -3'

Sequencing Primer
(F):5'- TTAAACCATGTTGGGGGCAC -3'
(R):5'- AGCTTACATCTTCTGAGCCTTG -3'
Posted On2014-03-14