Incidental Mutation 'R1400:Tlr7'
ID160364
Institutional Source Beutler Lab
Gene Symbol Tlr7
Ensembl Gene ENSMUSG00000044583
Gene Nametoll-like receptor 7
SynonymsRP23-139P21.3
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1400 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location167304929-167330558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167307849 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 214 (N214Y)
Ref Sequence ENSEMBL: ENSMUSP00000107789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060719] [ENSMUST00000112161] [ENSMUST00000112164]
Predicted Effect probably damaging
Transcript: ENSMUST00000060719
AA Change: N214Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061853
Gene: ENSMUSG00000044583
AA Change: N214Y

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
Pfam:LRR_7 676 692 7.2e-2 PFAM
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 4.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112161
AA Change: N214Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107787
Gene: ENSMUSG00000044583
AA Change: N214Y

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
Pfam:LRR_7 676 692 7.2e-2 PFAM
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 4.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112164
AA Change: N214Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107789
Gene: ENSMUSG00000044583
AA Change: N214Y

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 891 1049 1.7e-16 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype The innate immune response to viral infection is affected in homozygous null mice. Mice homozygous or hemizygous for a point mutation produce little or no tumor necrosis factor (TNF) alpha in response to stimulation by a single stranded RNA analog.
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C101F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S35P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 R43P unknown Het
Hoxa13 G C 6: 52,260,648 R43G unknown Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T407A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T397I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Sepn1 A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V7I probably damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y315H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 S404G probably damaging Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Tlr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Tlr7 APN X 167308475 unclassified possibly damaging 0.94
IGL01064:Tlr7 APN X 167308211 unclassified probably damaging 1.00
IGL02940:Tlr7 APN X 167307834 unclassified probably benign 0.01
IGL03064:Tlr7 APN X 167306207 unclassified possibly damaging 0.89
IGL03298:Tlr7 APN X 167306707 unclassified probably benign 0.45
rsq1 UTSW X 167308286 missense probably damaging 1.00
rsq2 UTSW X 167307945 missense probably damaging 0.98
rsq3 UTSW X 167307945 missense probably damaging 0.98
R1883:Tlr7 UTSW X 167306472 missense probably benign 0.35
R5929:Tlr7 UTSW X 167306882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAGGTCAAGAACTTCCAGCC -3'
(R):5'- CACAGGATCTGCCATCCAGCTTAC -3'

Sequencing Primer
(F):5'- TTAAACCATGTTGGGGGCAC -3'
(R):5'- AGCTTACATCTTCTGAGCCTTG -3'
Posted OnMar 14, 2014