Incidental Mutation 'R1406:Rab32'
ID160391
Institutional Source Beutler Lab
Gene Symbol Rab32
Ensembl Gene ENSMUSG00000019832
Gene NameRAB32, member RAS oncogene family
Synonyms2810011A17Rik
Accession Numbers

Genbank: NM_026405; MGI: 1915094

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location10545002-10558265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10550893 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000019974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019974] [ENSMUST00000220018]
Predicted Effect probably damaging
Transcript: ENSMUST00000019974
AA Change: V103A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019974
Gene: ENSMUSG00000019832
AA Change: V103A

DomainStartEndE-ValueType
RAB 24 193 3.44e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220018
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.2%
  • 20x: 76.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene anchors the type II regulatory subunit of protein kinase A to the mitochondrion and aids in mitochondrial fission. The encoded protein also appears to be involved in autophagy and melanosome secretion. Variations in this gene may be linked to leprosy. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Sp110 T G 1: 85,579,079 E421A probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Rab32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Rab32 APN 10 10550812 missense probably benign 0.07
IGL01061:Rab32 APN 10 10557874 missense probably damaging 0.99
IGL01071:Rab32 APN 10 10557847 missense probably damaging 1.00
IGL02193:Rab32 APN 10 10546455 splice site probably benign
IGL02814:Rab32 APN 10 10546427 missense probably benign
IGL03233:Rab32 APN 10 10546313 nonsense probably null
A5278:Rab32 UTSW 10 10557973 missense possibly damaging 0.94
R0135:Rab32 UTSW 10 10550840 missense probably damaging 1.00
R0514:Rab32 UTSW 10 10550896 missense probably damaging 1.00
R0826:Rab32 UTSW 10 10550867 missense possibly damaging 0.95
R1406:Rab32 UTSW 10 10550893 missense probably damaging 1.00
R2045:Rab32 UTSW 10 10550833 missense probably damaging 1.00
R4701:Rab32 UTSW 10 10550854 missense probably benign 0.04
R6665:Rab32 UTSW 10 10558102 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATCAGTGAAGCCAGCTCACCTTG -3'
(R):5'- ATTGTCAGCCACTTCTGCTAAGTCC -3'

Sequencing Primer
(F):5'- CTTGGCAGAGGTTTCAAACCATC -3'
(R):5'- GTGTGAAAGTCCTTAATTCCACCAG -3'
Posted On2014-03-14