Incidental Mutation 'R1403:Adam26a'
ID160447
Institutional Source Beutler Lab
Gene Symbol Adam26a
Ensembl Gene ENSMUSG00000048516
Gene Namea disintegrin and metallopeptidase domain 26A (testase 3)
SynonymsDtgn4, Adam26
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1403 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43568278-43576707 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 43569192 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 420 (C420*)
Ref Sequence ENSEMBL: ENSMUSP00000058256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049577]
Predicted Effect probably null
Transcript: ENSMUST00000049577
AA Change: C420*
SMART Domains Protein: ENSMUSP00000058256
Gene: ENSMUSG00000048516
AA Change: C420*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 2.1e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 2.2e-9 PFAM
Pfam:Reprolysin 195 385 2.7e-48 PFAM
Pfam:Reprolysin_2 215 377 2.4e-16 PFAM
Pfam:Reprolysin_3 219 340 1.2e-15 PFAM
DISIN 401 476 2.98e-41 SMART
ACR 477 613 2.06e-64 SMART
transmembrane domain 671 693 N/A INTRINSIC
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.5%
  • 10x: 88.5%
  • 20x: 65.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during the late stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to two other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Hspg2 C T 4: 137,540,100 L2042F possibly damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sp110 T G 1: 85,579,079 E421A probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Adam26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Adam26a APN 8 43568859 missense possibly damaging 0.75
IGL00519:Adam26a APN 8 43569525 missense probably damaging 1.00
IGL00658:Adam26a APN 8 43568903 missense probably benign 0.00
IGL01514:Adam26a APN 8 43568448 missense probably benign
IGL01988:Adam26a APN 8 43569170 missense possibly damaging 0.68
IGL02030:Adam26a APN 8 43568857 missense probably benign 0.00
IGL02081:Adam26a APN 8 43570196 missense probably damaging 0.99
IGL02444:Adam26a APN 8 43569673 missense possibly damaging 0.46
IGL02734:Adam26a APN 8 43569775 missense probably benign 0.27
IGL03243:Adam26a APN 8 43568696 missense probably benign 0.14
IGL03350:Adam26a APN 8 43569552 nonsense probably null
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0324:Adam26a UTSW 8 43568453 missense probably benign
R0830:Adam26a UTSW 8 43568402 missense probably benign 0.23
R0960:Adam26a UTSW 8 43568763 missense probably damaging 1.00
R1259:Adam26a UTSW 8 43568647 missense probably benign 0.20
R1259:Adam26a UTSW 8 43568713 missense possibly damaging 0.95
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1719:Adam26a UTSW 8 43570036 missense possibly damaging 0.93
R1750:Adam26a UTSW 8 43570189 missense possibly damaging 0.90
R1860:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1861:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1875:Adam26a UTSW 8 43569851 missense probably benign 0.37
R3959:Adam26a UTSW 8 43569871 missense probably benign 0.00
R4355:Adam26a UTSW 8 43570185 missense probably benign 0.35
R4604:Adam26a UTSW 8 43570051 missense probably benign 0.02
R4612:Adam26a UTSW 8 43568793 missense probably damaging 0.99
R4909:Adam26a UTSW 8 43570438 missense probably benign 0.08
R4937:Adam26a UTSW 8 43568881 missense probably damaging 1.00
R5112:Adam26a UTSW 8 43568856 missense probably benign 0.04
R5276:Adam26a UTSW 8 43570420 missense probably benign 0.30
R5406:Adam26a UTSW 8 43569104 missense probably damaging 1.00
R5501:Adam26a UTSW 8 43569904 nonsense probably null
R5955:Adam26a UTSW 8 43569852 missense probably benign 0.11
R6262:Adam26a UTSW 8 43569088 missense possibly damaging 0.91
R6847:Adam26a UTSW 8 43568428 missense probably benign 0.23
R6957:Adam26a UTSW 8 43568903 missense probably benign 0.00
Z1088:Adam26a UTSW 8 43569698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTCCGACACTGCTCATCACG -3'
(R):5'- TGGCACACATTGTAGCACACGAG -3'

Sequencing Primer
(F):5'- ACTGCTCATCACGTTGATGAC -3'
(R):5'- GGTTAAAAGACTGTCTAATGGCCC -3'
Posted On2014-03-14