Incidental Mutation 'R1405:Capn10'
ID160509
Institutional Source Beutler Lab
Gene Symbol Capn10
Ensembl Gene ENSMUSG00000026270
Gene Namecalpain 10
SynonymsCapn8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1405 (G1)
Quality Score222
Status Not validated
Chromosome1
Chromosomal Location92934376-92947941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 92945022 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 490 (V490G)
Ref Sequence ENSEMBL: ENSMUSP00000027488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027488] [ENSMUST00000117814] [ENSMUST00000152983]
Predicted Effect probably benign
Transcript: ENSMUST00000027488
AA Change: V490G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027488
Gene: ENSMUSG00000026270
AA Change: V490G

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.05e-60 SMART
calpain_III 507 645 1.3e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117814
SMART Domains Protein: ENSMUSP00000112831
Gene: ENSMUSG00000026270

DomainStartEndE-ValueType
CysPc 2 263 1.29e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136598
Predicted Effect probably benign
Transcript: ENSMUST00000152983
SMART Domains Protein: ENSMUSP00000122158
Gene: ENSMUSG00000026270

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.71e-60 SMART
low complexity region 490 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153828
Predicted Effect probably benign
Transcript: ENSMUST00000187342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191563
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to ryanodine- and palmitate-induced pancreatic apoptosis. Mice homozygous for a different knock-out allele exhibit increased adiposity, body and organ weights, and leptin serum levels on background containing LG/J. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Capn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Capn10 APN 1 92942559 missense probably benign 0.00
IGL01071:Capn10 APN 1 92945075 missense probably damaging 1.00
IGL01682:Capn10 APN 1 92940384 missense probably benign 0.16
IGL01771:Capn10 APN 1 92940365 missense probably damaging 1.00
IGL02952:Capn10 APN 1 92945174 missense probably damaging 0.97
IGL03177:Capn10 APN 1 92934982 missense probably benign 0.02
IGL03224:Capn10 APN 1 92939324 missense probably damaging 1.00
P4717OSA:Capn10 UTSW 1 92939394 missense probably damaging 1.00
R1256:Capn10 UTSW 1 92946946 missense probably damaging 1.00
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1653:Capn10 UTSW 1 92946898 missense probably damaging 1.00
R1737:Capn10 UTSW 1 92934955 missense probably benign 0.10
R2127:Capn10 UTSW 1 92938034 nonsense probably null
R2433:Capn10 UTSW 1 92942525 missense probably benign 0.22
R2484:Capn10 UTSW 1 92944843 missense probably damaging 0.97
R4004:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4005:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4560:Capn10 UTSW 1 92939362 missense probably damaging 1.00
R4684:Capn10 UTSW 1 92943781 missense probably damaging 1.00
R4766:Capn10 UTSW 1 92943419 missense probably damaging 0.98
R4996:Capn10 UTSW 1 92945136 missense probably damaging 1.00
R5665:Capn10 UTSW 1 92937931 splice site probably null
R5733:Capn10 UTSW 1 92943913 missense probably benign 0.03
R5937:Capn10 UTSW 1 92939383 missense probably damaging 1.00
R6985:Capn10 UTSW 1 92943424 missense probably damaging 1.00
R7140:Capn10 UTSW 1 92945271 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTTGAAGGATGTGCCAGGGCAG -3'
(R):5'- TGAGCTACCCCAAATGACCTCAGTG -3'

Sequencing Primer
(F):5'- GCAGTTCCTGCTCAGAGTC -3'
(R):5'- AGAAGCCAGCCTCTGTGTC -3'
Posted On2014-03-14