Incidental Mutation 'R1436:Pde8b'
ID160663
Institutional Source Beutler Lab
Gene Symbol Pde8b
Ensembl Gene ENSMUSG00000021684
Gene Namephosphodiesterase 8B
SynonymsB230331L10Rik, C030047E14Rik
MMRRC Submission 039491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R1436 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95024454-95250336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95026170 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 815 (T815A)
Ref Sequence ENSEMBL: ENSMUSP00000128987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022192] [ENSMUST00000056512] [ENSMUST00000067082] [ENSMUST00000160801] [ENSMUST00000162153] [ENSMUST00000162292] [ENSMUST00000162412] [ENSMUST00000172104]
Predicted Effect probably benign
Transcript: ENSMUST00000022192
AA Change: T823A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022192
Gene: ENSMUSG00000021684
AA Change: T823A

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.9e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 748 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056512
SMART Domains Protein: ENSMUSP00000055145
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067082
AA Change: T850A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070465
Gene: ENSMUSG00000021684
AA Change: T850A

DomainStartEndE-ValueType
Pfam:PDE8 1 47 1.4e-32 PFAM
low complexity region 75 98 N/A INTRINSIC
Blast:REC 112 235 6e-45 BLAST
PAS 249 316 3.59e-3 SMART
Blast:HDc 447 508 1e-20 BLAST
HDc 592 775 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160801
SMART Domains Protein: ENSMUSP00000124033
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162153
AA Change: T765A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124704
Gene: ENSMUSG00000021684
AA Change: T765A

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.6e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 362 423 1e-20 BLAST
HDc 507 690 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162292
AA Change: T773A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124068
Gene: ENSMUSG00000021684
AA Change: T773A

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.1e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.6e-15 PFAM
Blast:HDc 370 431 1e-20 BLAST
HDc 515 698 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162412
AA Change: T715A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124409
Gene: ENSMUSG00000021684
AA Change: T715A

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.3e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 312 373 1e-20 BLAST
HDc 457 640 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162670
SMART Domains Protein: ENSMUSP00000125237
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDEase_I 1 182 6.6e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162882
Predicted Effect probably benign
Transcript: ENSMUST00000172104
AA Change: T815A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128987
Gene: ENSMUSG00000021684
AA Change: T815A

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.8e-15 PFAM
PAS 269 336 3.59e-3 SMART
HDc 557 740 3.01e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223486
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased uring corticosterone, decreased serum adrenocorticotropin and decreased sensitivity to a PDE8-selective inhibitor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,644,213 F292S probably benign Het
Abca13 T C 11: 9,292,646 V1503A probably damaging Het
AI661453 C T 17: 47,466,702 probably benign Het
Ano2 T C 6: 125,867,171 probably null Het
Areg G T 5: 91,139,805 probably benign Het
Atg16l2 A G 7: 101,291,550 V453A probably damaging Het
BC034090 A G 1: 155,225,916 S563P probably benign Het
Bhmt-ps1 A G 4: 26,369,591 noncoding transcript Het
Birc6 C A 17: 74,652,705 P3855Q probably damaging Het
Cd151 A T 7: 141,469,284 K8M probably damaging Het
Cd163 T C 6: 124,327,931 V1089A possibly damaging Het
Chd3 A T 11: 69,357,574 probably null Het
Cnot6l T A 5: 96,134,112 E9V probably damaging Het
Col22a1 A G 15: 71,922,957 probably benign Het
Cyp2c68 A G 19: 39,741,040 M1T probably null Het
Dbp T C 7: 45,708,455 V149A probably damaging Het
Dnah10 T C 5: 124,762,221 V1241A probably benign Het
Galnt10 T C 11: 57,771,469 S314P probably damaging Het
Glce C T 9: 62,070,010 probably null Het
Gm5093 C G 17: 46,439,754 D116H probably damaging Het
Gm8298 A T 3: 59,865,339 D88V probably damaging Het
Golim4 A G 3: 75,878,644 probably null Het
Helz2 A T 2: 181,235,524 I1107N probably damaging Het
Hoxc9 T C 15: 102,981,872 S74P probably benign Het
Ikbkb T A 8: 22,673,403 N297I probably benign Het
Il20ra T A 10: 19,749,252 I93N probably damaging Het
Itch C A 2: 155,192,145 N412K probably damaging Het
Kcna5 T A 6: 126,534,761 T135S probably damaging Het
Lncpint G A 6: 31,181,039 noncoding transcript Het
Lrrc39 A T 3: 116,579,644 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Moxd1 C T 10: 24,244,358 T128M probably damaging Het
Mpeg1 C T 19: 12,462,459 S427F probably damaging Het
Nckap5 T C 1: 126,026,061 Y854C possibly damaging Het
Ncln C T 10: 81,489,893 E373K probably damaging Het
Neurod4 T C 10: 130,270,671 T245A possibly damaging Het
Nsun5 T C 5: 135,370,213 L39P probably damaging Het
Olfr1202 A T 2: 88,817,992 T274S possibly damaging Het
Olfr1303 A G 2: 111,814,561 L55S probably damaging Het
Olfr1368 G T 13: 21,142,992 Q22K probably benign Het
Pofut2 C T 10: 77,268,564 R392W probably damaging Het
Ppip5k2 G A 1: 97,711,782 T1186I probably benign Het
Rhot2 A C 17: 25,841,400 S277R probably benign Het
Satb1 T G 17: 51,804,363 probably null Het
Sec31b T C 19: 44,536,195 I88V probably damaging Het
Selenon T A 4: 134,540,686 E483V probably damaging Het
Serpinc1 A G 1: 160,993,411 T22A possibly damaging Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sf3b1 A G 1: 55,001,421 Y561H possibly damaging Het
Smarcc1 T A 9: 110,118,640 probably benign Het
Stard3nl C T 13: 19,372,649 R107Q probably damaging Het
Syce1 C T 7: 140,777,680 R324H possibly damaging Het
Tnk1 G T 11: 69,852,293 probably benign Het
Trim46 A G 3: 89,243,661 F198L probably damaging Het
Trip4 A T 9: 65,880,951 W71R probably damaging Het
Ubox5 A C 2: 130,597,293 probably benign Het
Ust G A 10: 8,307,438 T167M probably damaging Het
Zbtb2 T C 10: 4,368,697 Q443R probably benign Het
Zfp407 A G 18: 84,343,071 probably benign Het
Other mutations in Pde8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Pde8b APN 13 95034367 missense probably damaging 1.00
IGL01517:Pde8b APN 13 95100887 critical splice donor site probably null
IGL01736:Pde8b APN 13 95030402 missense probably damaging 1.00
IGL01756:Pde8b APN 13 95046387 missense probably damaging 1.00
IGL01867:Pde8b APN 13 95100938 missense probably damaging 0.99
IGL01939:Pde8b APN 13 95095724 missense probably damaging 0.98
IGL02026:Pde8b APN 13 95034361 missense probably damaging 1.00
IGL02685:Pde8b APN 13 95026120 makesense probably null
IGL02830:Pde8b APN 13 95052901 missense probably benign 0.02
IGL02966:Pde8b APN 13 95095648 missense probably damaging 0.96
IGL03003:Pde8b APN 13 95041957 missense probably damaging 1.00
IGL03064:Pde8b APN 13 95046398 missense probably damaging 1.00
IGL03349:Pde8b APN 13 95043043 splice site probably benign
R0356:Pde8b UTSW 13 95046454 missense probably damaging 0.96
R0464:Pde8b UTSW 13 95104698 missense probably damaging 1.00
R0711:Pde8b UTSW 13 95107817 missense possibly damaging 0.87
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1494:Pde8b UTSW 13 95047796 missense probably damaging 1.00
R1546:Pde8b UTSW 13 95046443 missense probably damaging 1.00
R1699:Pde8b UTSW 13 95032866 missense probably damaging 1.00
R1795:Pde8b UTSW 13 95042019 missense probably benign 0.10
R1879:Pde8b UTSW 13 95085215 missense possibly damaging 0.95
R2184:Pde8b UTSW 13 95026215 missense probably damaging 1.00
R2223:Pde8b UTSW 13 95043447 missense probably damaging 1.00
R2892:Pde8b UTSW 13 95034259 missense probably damaging 1.00
R3034:Pde8b UTSW 13 95222767 missense probably damaging 1.00
R4204:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4206:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4623:Pde8b UTSW 13 95041939 missense possibly damaging 0.69
R4711:Pde8b UTSW 13 95030450 missense probably benign 0.00
R5133:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5134:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5314:Pde8b UTSW 13 95086853 missense possibly damaging 0.89
R5342:Pde8b UTSW 13 95041990 missense probably damaging 0.99
R5376:Pde8b UTSW 13 95026146 missense probably benign 0.00
R5806:Pde8b UTSW 13 95042040 missense probably damaging 1.00
R5830:Pde8b UTSW 13 95041890 missense probably benign 0.01
R6021:Pde8b UTSW 13 95026162 missense possibly damaging 0.47
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6129:Pde8b UTSW 13 95041959 missense probably damaging 0.98
R6181:Pde8b UTSW 13 95086808 missense probably benign 0.36
R6313:Pde8b UTSW 13 95042000 nonsense probably null
R6849:Pde8b UTSW 13 95047799 missense possibly damaging 0.89
R6914:Pde8b UTSW 13 95086844 missense probably benign 0.06
R6999:Pde8b UTSW 13 95086834 missense possibly damaging 0.91
R7149:Pde8b UTSW 13 95086841 missense probably benign 0.03
R7275:Pde8b UTSW 13 95042934 missense probably damaging 1.00
R7483:Pde8b UTSW 13 95027743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAAGGGCACGCAGGCTAAC -3'
(R):5'- GGATACACATGCACACAGATGCCAG -3'

Sequencing Primer
(F):5'- AGGCAGCTCGTTTTGTCAC -3'
(R):5'- tctgtcccctagagctgag -3'
Posted On2014-03-14