Incidental Mutation 'R1447:Usp47'
ID160704
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Nameubiquitin specific peptidase 47
SynonymsA630020C16Rik, 4930502N04Rik
MMRRC Submission 039502-MU
Accession Numbers

Genbank: NM_133758; MGI: 1922246

Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R1447 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location112023504-112111661 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 112074568 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000210309] [ENSMUST00000215510]
Predicted Effect probably null
Transcript: ENSMUST00000106653
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106653
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000210309
Predicted Effect probably null
Transcript: ENSMUST00000210309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211791
Predicted Effect probably null
Transcript: ENSMUST00000215510
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 84.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,965,586 L2048P probably damaging Het
Adamts12 A T 15: 11,263,361 D603V probably benign Het
Ahnak A T 19: 9,007,082 E1910V probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amotl1 A G 9: 14,555,742 V704A probably benign Het
Ankrd50 A T 3: 38,455,542 V892E probably damaging Het
Aoc1 G A 6: 48,906,242 V351I probably benign Het
Atp6v1b1 T C 6: 83,757,942 V412A possibly damaging Het
Atp8b2 A T 3: 89,944,170 I906N probably damaging Het
BC005561 T C 5: 104,522,204 S1531P possibly damaging Het
Bnc2 A G 4: 84,293,220 V304A probably benign Het
Btaf1 A G 19: 36,992,454 D1176G probably benign Het
C1qtnf3 G A 15: 10,952,649 G66R probably damaging Het
Ccdc162 T C 10: 41,580,247 E360G probably damaging Het
Csmd1 C A 8: 15,925,306 G2968* probably null Het
Cyp2j7 A T 4: 96,195,293 F473L possibly damaging Het
Ddx24 T C 12: 103,424,307 K142E possibly damaging Het
Dnah1 A T 14: 31,306,898 M625K probably benign Het
Dnah9 A T 11: 66,108,482 Y944N possibly damaging Het
Eef1akmt1 T A 14: 57,565,984 K38* probably null Het
Enpp2 C T 15: 54,919,598 probably null Het
Eps8l1 A G 7: 4,474,056 E508G probably damaging Het
Etaa1 A T 11: 17,946,625 D497E possibly damaging Het
Fam181b C T 7: 93,080,160 A47V probably damaging Het
Fubp3 T C 2: 31,600,547 V221A probably damaging Het
Golga2 T C 2: 32,297,776 V191A possibly damaging Het
Haus5 G T 7: 30,661,791 probably null Het
Hydin T C 8: 110,523,166 L2247P probably damaging Het
Lama5 A C 2: 180,185,878 I2197S probably damaging Het
Mapre3 C T 5: 30,861,807 probably benign Het
Mast2 C A 4: 116,312,013 M733I probably benign Het
Mphosph10 A T 7: 64,380,950 F514I probably damaging Het
Mterf3 A G 13: 66,917,039 L266P probably damaging Het
Nup205 A G 6: 35,215,185 D1114G probably benign Het
Olfr356 T G 2: 36,937,776 V219G possibly damaging Het
Olfr380 A G 11: 73,453,874 F113L probably benign Het
Phf24 G T 4: 42,938,232 E119* probably null Het
Pik3r5 G A 11: 68,494,177 R636Q probably benign Het
Pla2g16 G A 19: 7,579,233 R133H probably benign Het
Rida T A 15: 34,488,611 Q45L possibly damaging Het
Ros1 T C 10: 52,098,858 T1544A possibly damaging Het
Rpl7 T A 1: 16,102,597 Y166F probably benign Het
Rps6ka5 A G 12: 100,577,825 I338T probably benign Het
Scn3a A T 2: 65,469,980 N1347K probably damaging Het
Serpinb6d A G 13: 33,670,756 D238G probably benign Het
Sh3rf2 T A 18: 42,101,671 I173N probably benign Het
Smarcc2 T C 10: 128,469,791 probably null Het
Thsd4 T C 9: 59,997,213 N567D probably benign Het
Tmprss13 C A 9: 45,328,580 P62Q unknown Het
Tmprss7 T C 16: 45,680,670 Q256R probably benign Het
Tssc4 A G 7: 143,070,155 T67A probably benign Het
Tssk5 G A 15: 76,372,104 Q372* probably null Het
Utp15 A G 13: 98,252,878 I304T possibly damaging Het
Vmn1r35 A C 6: 66,678,906 V93G probably benign Het
Zfhx3 A C 8: 108,948,444 Q2042P probably benign Het
Zfp532 C A 18: 65,624,990 R665S probably damaging Het
Zfp976 G T 7: 42,612,599 P605T possibly damaging Het
Zfpl1 A G 19: 6,082,619 V125A possibly damaging Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 112074783 missense probably benign 0.00
IGL00574:Usp47 APN 7 112063335 missense probably damaging 1.00
IGL00975:Usp47 APN 7 112093370 missense probably damaging 1.00
IGL01289:Usp47 APN 7 112063358 missense probably damaging 1.00
IGL01419:Usp47 APN 7 112087911 missense possibly damaging 0.94
IGL01645:Usp47 APN 7 112054862 missense probably damaging 0.96
IGL01871:Usp47 APN 7 112077786 splice site probably benign
IGL02066:Usp47 APN 7 112064397 missense probably damaging 1.00
IGL02122:Usp47 APN 7 112106908 missense probably damaging 0.97
IGL02153:Usp47 APN 7 112104049 missense probably benign 0.00
IGL02550:Usp47 APN 7 112104354 missense probably damaging 1.00
IGL02710:Usp47 APN 7 112092925 missense probably benign 0.01
IGL02756:Usp47 APN 7 112093063 missense possibly damaging 0.76
IGL03093:Usp47 APN 7 112089620 missense probably damaging 1.00
IGL03398:Usp47 APN 7 112074503 missense probably damaging 1.00
0152:Usp47 UTSW 7 112056577 missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 112104341 splice site probably benign
R0110:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0381:Usp47 UTSW 7 112063393 critical splice donor site probably null
R0450:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0634:Usp47 UTSW 7 112108655 missense probably damaging 1.00
R0881:Usp47 UTSW 7 112091436 missense possibly damaging 0.51
R1178:Usp47 UTSW 7 112109998 missense possibly damaging 0.68
R1640:Usp47 UTSW 7 112083127 missense probably damaging 0.99
R1727:Usp47 UTSW 7 112086100 missense probably damaging 0.96
R1866:Usp47 UTSW 7 112101870 missense possibly damaging 0.93
R1876:Usp47 UTSW 7 112054920 missense probably damaging 0.99
R1953:Usp47 UTSW 7 112092876 missense probably benign 0.26
R2117:Usp47 UTSW 7 112067236 critical splice donor site probably null
R2176:Usp47 UTSW 7 112092727 missense probably benign 0.00
R2187:Usp47 UTSW 7 112067191 missense probably damaging 1.00
R2504:Usp47 UTSW 7 112104470 critical splice donor site probably null
R2902:Usp47 UTSW 7 112093451 missense probably damaging 1.00
R2922:Usp47 UTSW 7 112093198 missense probably damaging 1.00
R2939:Usp47 UTSW 7 112082536 missense probably damaging 1.00
R4065:Usp47 UTSW 7 112053416 missense probably benign 0.30
R4179:Usp47 UTSW 7 112087884 missense probably damaging 1.00
R4235:Usp47 UTSW 7 112110048 missense probably damaging 0.99
R4243:Usp47 UTSW 7 112108629 missense probably damaging 1.00
R4281:Usp47 UTSW 7 112109993 missense probably benign 0.03
R4360:Usp47 UTSW 7 112054932 missense probably damaging 1.00
R4604:Usp47 UTSW 7 112101831 missense probably damaging 1.00
R4857:Usp47 UTSW 7 112082552 missense probably damaging 1.00
R5133:Usp47 UTSW 7 112083882 missense probably damaging 1.00
R5179:Usp47 UTSW 7 112093432 missense probably damaging 1.00
R5322:Usp47 UTSW 7 112053269 missense probably damaging 0.99
R5445:Usp47 UTSW 7 112074721 missense probably damaging 1.00
R5465:Usp47 UTSW 7 112059002 missense probably damaging 1.00
R5699:Usp47 UTSW 7 112109997 missense probably benign 0.00
R5961:Usp47 UTSW 7 112053316 missense probably damaging 1.00
R6117:Usp47 UTSW 7 112087932 missense probably damaging 0.98
R6271:Usp47 UTSW 7 112087056 missense probably damaging 1.00
R7155:Usp47 UTSW 7 112087013 missense probably damaging 0.97
R7229:Usp47 UTSW 7 112092877 missense probably benign 0.04
R7285:Usp47 UTSW 7 112093108 missense probably benign 0.02
X0027:Usp47 UTSW 7 112087847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCATAGCTCAGGACCTACCTACTT -3'
(R):5'- TGTGCTCATATCCAGCTCCTCCG -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- CCGGAAATGACATTCGATCATTCAG -3'
Posted On2014-03-14