Incidental Mutation 'R1438:Dnah10'
ID160758
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Namedynein, axonemal, heavy chain 10
SynonymsDnahc10
MMRRC Submission 039493-MU
Accession Numbers

Ncbi RefSeq: NM_019536.1; MGI:1860299

Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124725085-124834308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124798945 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 2559 (N2559S)
Ref Sequence ENSEMBL: ENSMUSP00000114593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
Predicted Effect probably benign
Transcript: ENSMUST00000058440
AA Change: N2616S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: N2616S

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126998
Predicted Effect probably benign
Transcript: ENSMUST00000141137
AA Change: N2559S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: N2559S

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197824
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124828603 missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124746616 missense probably benign 0.01
IGL00471:Dnah10 APN 5 124794341 missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124775512 missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124777212 missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124779154 missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124783946 missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124821341 missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124732489 missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124803328 missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124787465 missense probably benign 0.10
IGL01757:Dnah10 APN 5 124768927 missense probably benign 0.37
IGL01759:Dnah10 APN 5 124755786 missense probably benign
IGL01767:Dnah10 APN 5 124743737 splice site probably benign
IGL01769:Dnah10 APN 5 124764944 missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124783921 missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124789812 missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124804746 missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124819366 missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124833423 critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124773067 missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124773819 missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124789796 missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124793852 missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124821287 missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124787331 missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124799005 missense probably benign 0.26
IGL02709:Dnah10 APN 5 124773745 nonsense probably null
IGL02740:Dnah10 APN 5 124826863 splice site probably benign
IGL02746:Dnah10 APN 5 124730086 missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124798014 missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124801822 missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124763133 missense probably benign 0.07
IGL03076:Dnah10 APN 5 124730162 critical splice donor site probably null
IGL03109:Dnah10 APN 5 124764886 missense probably benign 0.10
IGL03181:Dnah10 APN 5 124748457 missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124817643 missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124817697 missense probably benign 0.00
IGL03328:Dnah10 APN 5 124754290 missense probably benign 0.06
frosty UTSW 5 124828137 missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124829529 missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124730100 missense probably benign
P0019:Dnah10 UTSW 5 124763066 missense probably benign
P0037:Dnah10 UTSW 5 124817992 nonsense probably null
R0004:Dnah10 UTSW 5 124726902 missense probably benign
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124830744 missense probably benign 0.00
R0066:Dnah10 UTSW 5 124763076 missense probably benign 0.01
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124834075 missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124796369 splice site probably benign
R0321:Dnah10 UTSW 5 124823352 missense probably benign 0.29
R0410:Dnah10 UTSW 5 124755735 missense probably benign
R0480:Dnah10 UTSW 5 124808851 missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124812723 critical splice donor site probably null
R0533:Dnah10 UTSW 5 124775250 splice site probably null
R0599:Dnah10 UTSW 5 124800953 missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124750812 missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124829577 missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124797938 missense probably benign 0.00
R1203:Dnah10 UTSW 5 124760014 splice site probably null
R1248:Dnah10 UTSW 5 124755823 splice site probably benign
R1366:Dnah10 UTSW 5 124753326 missense probably benign 0.41
R1434:Dnah10 UTSW 5 124774986 missense probably benign 0.03
R1436:Dnah10 UTSW 5 124762221 missense probably benign 0.00
R1446:Dnah10 UTSW 5 124789796 missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124743686 missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1479:Dnah10 UTSW 5 124777889 missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124754239 missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124760952 missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124829614 missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124765562 missense probably benign 0.00
R1709:Dnah10 UTSW 5 124760091 missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124773190 intron probably null
R1828:Dnah10 UTSW 5 124761279 missense probably benign 0.00
R1854:Dnah10 UTSW 5 124804689 missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124832526 unclassified probably null
R1893:Dnah10 UTSW 5 124754317 missense probably benign 0.13
R1895:Dnah10 UTSW 5 124758430 missense probably benign 0.00
R1906:Dnah10 UTSW 5 124800984 missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124782268 missense probably benign 0.00
R1965:Dnah10 UTSW 5 124775203 missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124833988 missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124829587 missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124746704 missense probably benign 0.30
R2046:Dnah10 UTSW 5 124796341 missense probably benign 0.25
R2074:Dnah10 UTSW 5 124814674 missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124774981 missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124761237 missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124731466 missense probably benign 0.00
R2293:Dnah10 UTSW 5 124819221 missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124742000 missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124762865 critical splice donor site probably null
R2571:Dnah10 UTSW 5 124775478 missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124817670 missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124819412 critical splice donor site probably null
R3439:Dnah10 UTSW 5 124796258 missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124747630 missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124773031 missense probably benign 0.37
R4015:Dnah10 UTSW 5 124777926 missense probably benign 0.25
R4261:Dnah10 UTSW 5 124730137 missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124732330 missense probably benign 0.28
R4299:Dnah10 UTSW 5 124819925 missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124762869 splice site probably null
R4651:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4652:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4664:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124775517 missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124747745 missense probably benign 0.01
R4806:Dnah10 UTSW 5 124819344 missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124773132 missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124817748 missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124762196 missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124832513 missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5119:Dnah10 UTSW 5 124779258 missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124798960 missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124787420 missense probably benign 0.00
R5262:Dnah10 UTSW 5 124785156 missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124828137 missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124791787 missense probably benign 0.01
R5322:Dnah10 UTSW 5 124773566 missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124743629 missense probably benign 0.16
R5468:Dnah10 UTSW 5 124830493 missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124753168 missense probably benign
R5587:Dnah10 UTSW 5 124793913 missense probably benign 0.10
R5724:Dnah10 UTSW 5 124742026 missense probably benign 0.27
R5797:Dnah10 UTSW 5 124821386 missense probably benign 0.00
R5812:Dnah10 UTSW 5 124747746 missense probably benign 0.01
R5846:Dnah10 UTSW 5 124823373 missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R5961:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5970:Dnah10 UTSW 5 124808729 missense probably benign
R6021:Dnah10 UTSW 5 124736984 missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124801860 missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124819210 missense probably benign 0.09
R6080:Dnah10 UTSW 5 124805897 missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124753174 missense probably benign 0.18
R6155:Dnah10 UTSW 5 124770599 missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124785175 missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124823318 missense probably benign 0.02
R6238:Dnah10 UTSW 5 124743679 missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124794219 splice site probably null
R6275:Dnah10 UTSW 5 124785184 missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124775080 missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124829646 missense probably benign 0.00
R6458:Dnah10 UTSW 5 124809269 missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124762782 missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124758355 missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124830033 missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124760159 missense probably benign 0.45
R6702:Dnah10 UTSW 5 124805805 missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124808812 missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124777826 missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124790000 intron probably null
R6932:Dnah10 UTSW 5 124821450 missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124787426 missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124816142 missense not run
R7138:Dnah10 UTSW 5 124822945 missense not run
R7144:Dnah10 UTSW 5 124822942 missense not run
T0975:Dnah10 UTSW 5 124763066 missense probably benign
U24488:Dnah10 UTSW 5 124813980 missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124765697 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CCAAGGCTCCTGAGTAAATAAGGACAC -3'
(R):5'- GAGAGGAACATTGAGATCTGCCACC -3'

Sequencing Primer
(F):5'- tcctcttgcctctgcctc -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-03-14