Incidental Mutation 'R1438:Ripply2'
ID160779
Institutional Source Beutler Lab
Gene Symbol Ripply2
Ensembl Gene ENSMUSG00000047897
Gene Nameripply transcriptional repressor 2
SynonymsC030002E08Rik, LOC382089
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87015537-87019917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87019660 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 80 (W80R)
Ref Sequence ENSEMBL: ENSMUSP00000055369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058846] [ENSMUST00000168529]
Predicted Effect probably damaging
Transcript: ENSMUST00000058846
AA Change: W80R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055369
Gene: ENSMUSG00000047897
AA Change: W80R

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Ripply 33 118 2.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168529
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174724
SMART Domains Protein: ENSMUSP00000133556
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.2e-16 PFAM
Pfam:FAD_binding_6 284 391 1.7e-22 PFAM
Pfam:NAD_binding_1 402 509 3.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188187
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that belongs to a novel family of proteins required for vertebrate somitogenesis. Members of this family have a tetrapeptide WRPW motif that is required for interaction with the transcriptional repressor Groucho and a carboxy-terminal Ripply homology domain/Bowline-DSCR-Ledgerline conserved region required for transcriptional repression. Null mutant mice die soon after birth and display defects in axial skeleton segmentation due to defective somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, rib and vertebral abnormalities, impaired somite formation, decreased body length, and short tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Ripply2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Ripply2 APN 9 87015956 splice site probably benign
R0369:Ripply2 UTSW 9 87016319 missense probably damaging 1.00
R4785:Ripply2 UTSW 9 87019796 missense probably damaging 1.00
R4980:Ripply2 UTSW 9 87019694 missense probably damaging 1.00
R5330:Ripply2 UTSW 9 87015638 splice site probably benign
R5331:Ripply2 UTSW 9 87015638 splice site probably benign
R5345:Ripply2 UTSW 9 87019726 unclassified probably null
R5482:Ripply2 UTSW 9 87015567 missense possibly damaging 0.72
R5834:Ripply2 UTSW 9 87015890 missense probably damaging 1.00
R6357:Ripply2 UTSW 9 87016278 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGTTCACTGGCAAGCAGACTCC -3'
(R):5'- GCAGCACCCAGTTTTCCTCACTAAC -3'

Sequencing Primer
(F):5'- CATGGAAACTGTAACAGTAGCAGC -3'
(R):5'- ACGAAATTGTAGCTTGAATTGGG -3'
Posted On2014-03-14