Incidental Mutation 'R1438:Adgrg6'
ID160781
Institutional Source Beutler Lab
Gene Symbol Adgrg6
Ensembl Gene ENSMUSG00000039116
Gene Nameadhesion G protein-coupled receptor G6
SynonymsLOC215798, 1190004A11Rik, DREG, Gpr126
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location14402583-14545659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14468841 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 123 (S123G)
Ref Sequence ENSEMBL: ENSMUSP00000043055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041168] [ENSMUST00000208429]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041168
AA Change: S123G

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043055
Gene: ENSMUSG00000039116
AA Change: S123G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CUB 41 149 8.59e-33 SMART
low complexity region 609 620 N/A INTRINSIC
low complexity region 695 706 N/A INTRINSIC
GPS 769 822 2.48e-12 SMART
Pfam:7tm_2 831 1080 4.1e-52 PFAM
low complexity region 1122 1154 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208429
AA Change: S123G

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is upregulated in human umbilical vein endothelial cells, encodes a G protein-coupled receptor. Variations in this gene can affect a person's stature. Multiple transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation die during organogenesis and display signs of circulatory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Adgrg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Adgrg6 APN 10 14467450 missense probably damaging 0.99
IGL00428:Adgrg6 APN 10 14467375 missense probably benign
IGL00489:Adgrg6 APN 10 14440403 splice site probably null
IGL00496:Adgrg6 APN 10 14450578 critical splice donor site probably null
IGL00743:Adgrg6 APN 10 14535959 splice site probably benign
IGL01011:Adgrg6 APN 10 14409798 missense probably damaging 0.96
IGL01291:Adgrg6 APN 10 14410530 missense possibly damaging 0.92
IGL01453:Adgrg6 APN 10 14420458 missense possibly damaging 0.94
IGL01594:Adgrg6 APN 10 14434340 missense probably damaging 1.00
IGL02013:Adgrg6 APN 10 14426811 missense probably damaging 0.98
IGL02037:Adgrg6 APN 10 14441441 missense probably damaging 0.98
IGL02070:Adgrg6 APN 10 14467592 missense probably damaging 1.00
IGL02164:Adgrg6 APN 10 14523555 intron probably benign
IGL02262:Adgrg6 APN 10 14441396 missense probably benign 0.00
IGL02272:Adgrg6 APN 10 14468829 missense probably damaging 1.00
IGL02605:Adgrg6 APN 10 14467232 missense probably damaging 1.00
IGL02800:Adgrg6 APN 10 14420605 missense probably damaging 1.00
IGL03175:Adgrg6 APN 10 14439758 missense probably benign 0.04
ANU05:Adgrg6 UTSW 10 14410530 missense possibly damaging 0.92
R0245:Adgrg6 UTSW 10 14458066 splice site probably benign
R0356:Adgrg6 UTSW 10 14426898 missense possibly damaging 0.47
R0388:Adgrg6 UTSW 10 14450658 missense probably benign 0.00
R0508:Adgrg6 UTSW 10 14450616 missense probably benign 0.32
R0626:Adgrg6 UTSW 10 14436884 missense probably damaging 1.00
R1116:Adgrg6 UTSW 10 14438428 missense probably benign 0.00
R1205:Adgrg6 UTSW 10 14434339 missense probably damaging 1.00
R1599:Adgrg6 UTSW 10 14467313 nonsense probably null
R1714:Adgrg6 UTSW 10 14439770 missense possibly damaging 0.64
R1728:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1729:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1784:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R2124:Adgrg6 UTSW 10 14467186 missense probably damaging 0.98
R2906:Adgrg6 UTSW 10 14432950 missense probably benign 0.03
R3410:Adgrg6 UTSW 10 14440370 missense probably benign 0.10
R3982:Adgrg6 UTSW 10 14448845 missense probably benign 0.10
R4376:Adgrg6 UTSW 10 14438494 missense probably benign 0.02
R4376:Adgrg6 UTSW 10 14469050 missense probably damaging 1.00
R4445:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4446:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4472:Adgrg6 UTSW 10 14436781 missense probably damaging 1.00
R4622:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4623:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4649:Adgrg6 UTSW 10 14468827 missense probably damaging 1.00
R4882:Adgrg6 UTSW 10 14434337 missense possibly damaging 0.88
R4978:Adgrg6 UTSW 10 14420461 missense probably damaging 1.00
R5246:Adgrg6 UTSW 10 14426765 missense probably damaging 1.00
R5420:Adgrg6 UTSW 10 14426986 nonsense probably null
R5461:Adgrg6 UTSW 10 14420504 missense probably damaging 1.00
R5580:Adgrg6 UTSW 10 14410484 nonsense probably null
R5644:Adgrg6 UTSW 10 14432934 missense probably damaging 1.00
R5847:Adgrg6 UTSW 10 14426777 missense probably damaging 1.00
R5900:Adgrg6 UTSW 10 14438419 critical splice donor site probably null
R6302:Adgrg6 UTSW 10 14441483 missense probably benign 0.22
R6318:Adgrg6 UTSW 10 14467497 missense probably benign
R6319:Adgrg6 UTSW 10 14431622 missense probably damaging 1.00
R6339:Adgrg6 UTSW 10 14434347 missense probably damaging 1.00
R6683:Adgrg6 UTSW 10 14456167 missense probably damaging 0.97
R6983:Adgrg6 UTSW 10 14431695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGACCATTCGCATAAAAGAGCC -3'
(R):5'- TGACAGTTACTGCTTGATGCCCC -3'

Sequencing Primer
(F):5'- AAGAGCCTAATTCTGTTCTCCAG -3'
(R):5'- CCCCCAGGAAGTAGGATTGTTG -3'
Posted On2014-03-14