Incidental Mutation 'R1438:Olfr57'
ID160783
Institutional Source Beutler Lab
Gene Symbol Olfr57
Ensembl Gene ENSMUSG00000060205
Gene Nameolfactory receptor 57
SynonymsGA_x6K02T2QGN0-2777431-2776472, IF12, MOR139-3
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79028741-79036274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79035288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 164 (V164E)
Ref Sequence ENSEMBL: ENSMUSP00000144814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082244] [ENSMUST00000203906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082244
AA Change: V164E

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080872
Gene: ENSMUSG00000060205
AA Change: V164E

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.2e-49 PFAM
Pfam:7tm_1 42 291 6e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203906
AA Change: V164E

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144814
Gene: ENSMUSG00000060205
AA Change: V164E

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Olfr57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr57 APN 10 79035611 missense probably benign 0.05
IGL02230:Olfr57 APN 10 79035042 missense probably damaging 0.99
IGL02283:Olfr57 APN 10 79035545 missense probably damaging 1.00
IGL02878:Olfr57 APN 10 79035558 missense probably benign 0.23
IGL02975:Olfr57 APN 10 79035033 missense possibly damaging 0.83
IGL03259:Olfr57 APN 10 79035400 nonsense probably null
R1366:Olfr57 UTSW 10 79035042 missense probably damaging 1.00
R1528:Olfr57 UTSW 10 79035564 missense probably damaging 0.96
R1601:Olfr57 UTSW 10 79035504 missense possibly damaging 0.56
R2032:Olfr57 UTSW 10 79035329 missense possibly damaging 0.86
R2112:Olfr57 UTSW 10 79035414 missense probably damaging 1.00
R2382:Olfr57 UTSW 10 79035134 missense possibly damaging 0.52
R2967:Olfr57 UTSW 10 79035053 missense probably damaging 1.00
R3773:Olfr57 UTSW 10 79035180 missense possibly damaging 0.95
R3940:Olfr57 UTSW 10 79035204 missense probably damaging 1.00
R4405:Olfr57 UTSW 10 79035410 missense probably benign
R5944:Olfr57 UTSW 10 79035389 missense probably benign 0.00
R6563:Olfr57 UTSW 10 79035217 missense possibly damaging 0.67
R6614:Olfr57 UTSW 10 79035091 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCACCACTGTTCCACAGATGCTG -3'
(R):5'- ACTTCCCCTGCACTGAGGAGATTG -3'

Sequencing Primer
(F):5'- CTGTTCCACAGATGCTGGTAAAC -3'
(R):5'- CACAAATGGAGGATACTATCCTAGAG -3'
Posted On2014-03-14