Incidental Mutation 'R1438:Rhbdd3'
ID160788
Institutional Source Beutler Lab
Gene Symbol Rhbdd3
Ensembl Gene ENSMUSG00000034175
Gene Namerhomboid domain containing 3
Synonyms
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5098926-5106093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5103332 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 44 (L44Q)
Ref Sequence ENSEMBL: ENSMUSP00000105504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036320] [ENSMUST00000062821] [ENSMUST00000063232] [ENSMUST00000073308] [ENSMUST00000079949] [ENSMUST00000093365] [ENSMUST00000101610] [ENSMUST00000102930] [ENSMUST00000109878] [ENSMUST00000134267] [ENSMUST00000139742] [ENSMUST00000148761] [ENSMUST00000150632] [ENSMUST00000163299]
Predicted Effect probably damaging
Transcript: ENSMUST00000036320
AA Change: L44Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044703
Gene: ENSMUSG00000034175
AA Change: L44Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 185 2.2e-7 PFAM
SCOP:d1ifya_ 308 351 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062821
SMART Domains Protein: ENSMUSP00000061704
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 101 8.7e-18 PFAM
low complexity region 200 211 N/A INTRINSIC
low complexity region 220 267 N/A INTRINSIC
Pfam:Collagen 282 342 5e-10 PFAM
Pfam:Collagen 312 377 4.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063232
SMART Domains Protein: ENSMUSP00000066827
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 51 71 N/A INTRINSIC
low complexity region 78 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073308
SMART Domains Protein: ENSMUSP00000073034
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 5.91e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 5.91e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
RRM 324 405 8.38e-17 SMART
low complexity region 416 475 N/A INTRINSIC
ZnF_RBZ 482 508 6.22e-7 SMART
low complexity region 512 586 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079949
SMART Domains Protein: ENSMUSP00000078867
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.98e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.98e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 331 N/A INTRINSIC
low complexity region 335 356 N/A INTRINSIC
RRM 361 442 8.38e-17 SMART
low complexity region 453 512 N/A INTRINSIC
ZnF_RBZ 519 545 6.22e-7 SMART
low complexity region 549 623 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093365
SMART Domains Protein: ENSMUSP00000091057
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.29e-5 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.29e-5 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101610
AA Change: L44Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099131
Gene: ENSMUSG00000034175
AA Change: L44Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 2.5e-7 PFAM
Pfam:UBA 323 358 3.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102930
SMART Domains Protein: ENSMUSP00000099994
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 3.23e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 97 127 N/A INTRINSIC
internal_repeat_1 161 176 3.23e-6 PROSPERO
low complexity region 193 217 N/A INTRINSIC
low complexity region 219 272 N/A INTRINSIC
low complexity region 306 337 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
RRM 367 448 8.38e-17 SMART
low complexity region 459 518 N/A INTRINSIC
ZnF_RBZ 525 551 6.22e-7 SMART
low complexity region 555 629 N/A INTRINSIC
low complexity region 635 645 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109878
AA Change: L44Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105504
Gene: ENSMUSG00000034175
AA Change: L44Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 2e-7 PFAM
SCOP:d1ifya_ 318 361 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132196
Predicted Effect probably benign
Transcript: ENSMUST00000132328
SMART Domains Protein: ENSMUSP00000117779
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
low complexity region 1 44 N/A INTRINSIC
Pfam:Collagen 59 113 4.5e-10 PFAM
Pfam:Collagen 89 152 2e-13 PFAM
low complexity region 154 169 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134267
AA Change: L44Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137370
Predicted Effect probably benign
Transcript: ENSMUST00000139742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146879
Predicted Effect probably damaging
Transcript: ENSMUST00000148761
AA Change: L44Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120264
Gene: ENSMUSG00000034175
AA Change: L44Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151847
Predicted Effect probably benign
Transcript: ENSMUST00000151906
SMART Domains Protein: ENSMUSP00000124014
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
Pfam:Collagen 2 68 8.4e-14 PFAM
low complexity region 72 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153308
SMART Domains Protein: ENSMUSP00000125605
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
Pfam:Collagen 1 49 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163299
SMART Domains Protein: ENSMUSP00000131391
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 33 101 7.3e-24 PFAM
low complexity region 198 209 N/A INTRINSIC
low complexity region 218 265 N/A INTRINSIC
Pfam:Collagen 280 340 5.1e-10 PFAM
Pfam:Collagen 310 375 4.3e-12 PFAM
Meta Mutation Damage Score 0.0224 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered stimulated NK cell activation and acute inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Rhbdd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Rhbdd3 APN 11 5105424 unclassified probably benign
IGL02376:Rhbdd3 APN 11 5103192 unclassified probably benign
R1387:Rhbdd3 UTSW 11 5104121 missense probably damaging 1.00
R4196:Rhbdd3 UTSW 11 5099460 unclassified probably benign
R4278:Rhbdd3 UTSW 11 5105329 missense probably benign 0.01
R4554:Rhbdd3 UTSW 11 5105946 missense probably benign 0.03
R4809:Rhbdd3 UTSW 11 5105949 missense probably damaging 0.99
R5594:Rhbdd3 UTSW 11 5105710 missense probably damaging 1.00
R5687:Rhbdd3 UTSW 11 5105707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGCCTCAGGACCACCTTTGAC -3'
(R):5'- AGGGATGTGATCAGCACTCCTACC -3'

Sequencing Primer
(F):5'- GGACCACCTTTGACTACCATC -3'
(R):5'- GATCAGCACTCCTACCCATGC -3'
Posted On2014-03-14