Incidental Mutation 'R1438:Dek'
ID160802
Institutional Source Beutler Lab
Gene Symbol Dek
Ensembl Gene ENSMUSG00000021377
Gene NameDEK oncogene (DNA binding)
SynonymsD13H6S231E, 1810019E15Rik
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location47084775-47106201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47088171 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 306 (S306T)
Ref Sequence ENSEMBL: ENSMUSP00000021807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021807] [ENSMUST00000037025] [ENSMUST00000135278] [ENSMUST00000224150]
Predicted Effect probably benign
Transcript: ENSMUST00000021807
AA Change: S306T

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021807
Gene: ENSMUSG00000021377
AA Change: S306T

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
low complexity region 190 210 N/A INTRINSIC
low complexity region 231 315 N/A INTRINSIC
Pfam:DEK_C 327 379 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037025
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128977
Predicted Effect probably benign
Transcript: ENSMUST00000135278
SMART Domains Protein: ENSMUSP00000121663
Gene: ENSMUSG00000021377

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138401
Predicted Effect probably benign
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224150
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed development of DMBA- and TPA-induced papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Dek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Dek APN 13 47088135 missense probably benign 0.37
R4118:Dek UTSW 13 47088600 missense probably benign 0.01
R5235:Dek UTSW 13 47086479 unclassified probably null
R5847:Dek UTSW 13 47101601 unclassified probably benign
R6285:Dek UTSW 13 47099380 missense probably damaging 1.00
R6736:Dek UTSW 13 47099390 missense probably damaging 1.00
R6903:Dek UTSW 13 47098187 missense possibly damaging 0.83
R7120:Dek UTSW 13 47100183 missense not run
Predicted Primers PCR Primer
(F):5'- ACAAGAGAGCCTGGAAACAGTTCAATC -3'
(R):5'- GAGGGATAGTAGTGACTCATGCTTTGC -3'

Sequencing Primer
(F):5'- GCCTGGAAACAGTTCAATCAATAGTC -3'
(R):5'- ACAGCAACTGTCAGCGTG -3'
Posted On2014-03-14