Incidental Mutation 'R1438:Scube1'
ID160810
Institutional Source Beutler Lab
Gene Symbol Scube1
Ensembl Gene ENSMUSG00000016763
Gene Namesignal peptide, CUB domain, EGF-like 1
Synonyms7330410C13Rik, A630023E24Rik
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R1438 (G1)
Quality Score183
Status Validated
Chromosome15
Chromosomal Location83604999-83725021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83615026 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 633 (C633R)
Ref Sequence ENSEMBL: ENSMUSP00000130131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016907] [ENSMUST00000043634] [ENSMUST00000076060] [ENSMUST00000171496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016907
AA Change: C663R

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016907
Gene: ENSMUSG00000016763
AA Change: C663R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 274 311 1.69e-3 SMART
EGF_CA 312 352 2.13e-9 SMART
EGF_CA 353 391 4.7e-11 SMART
EGF_CA 392 432 3.91e-8 SMART
low complexity region 560 573 N/A INTRINSIC
Pfam:GCC2_GCC3 666 713 4.5e-13 PFAM
EGF_like 766 804 6.81e1 SMART
CUB 828 940 1.51e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043634
AA Change: C552R

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044835
Gene: ENSMUSG00000016763
AA Change: C552R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 163 200 1.69e-3 SMART
EGF_CA 201 241 2.13e-9 SMART
EGF_CA 242 280 4.7e-11 SMART
EGF_CA 281 321 3.91e-8 SMART
low complexity region 449 462 N/A INTRINSIC
Pfam:GCC2_GCC3 555 602 3.2e-11 PFAM
EGF_like 655 693 6.81e1 SMART
CUB 717 829 1.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076060
AA Change: C633R

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075434
Gene: ENSMUSG00000016763
AA Change: C633R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.3e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144773
Predicted Effect possibly damaging
Transcript: ENSMUST00000171496
AA Change: C633R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130131
Gene: ENSMUSG00000016763
AA Change: C633R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.7e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230060
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface glycoprotein that is a member of the SCUBE (signal peptide, CUB domain, EGF (epidermal growth factor)-like protein) family. Family members have an amino-terminal signal peptide, nine copies of EGF-like repeats and a CUB domain at the carboxyl terminus. This protein is expressed in platelets and endothelial cells and may play an important role in vascular biology. [provided by RefSeq, Oct 2011]
PHENOTYPE: A fraction of homozygotes die neonatally with acrania and loss of brain tissue. Early skull bone defects include lack of the interparietal and supraoccipital bones and cranial vault. Affected mutant embryos show exencephaly, a thick-walled forebrain neuroepithelium and hyperplastic cranial ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Scube1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Scube1 APN 15 83703501 missense probably damaging 0.98
IGL01152:Scube1 APN 15 83613570 missense probably damaging 1.00
IGL01388:Scube1 APN 15 83620131 missense probably benign 0.00
IGL01589:Scube1 APN 15 83612553 missense probably damaging 1.00
IGL02208:Scube1 APN 15 83703540 missense probably damaging 1.00
IGL02305:Scube1 APN 15 83607390 missense probably damaging 1.00
IGL02728:Scube1 APN 15 83659016 splice site probably benign
IGL02737:Scube1 APN 15 83721843 splice site probably benign
IGL03326:Scube1 APN 15 83607416 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0126:Scube1 UTSW 15 83621063 missense probably damaging 1.00
R0792:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1522:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1735:Scube1 UTSW 15 83607437 missense probably damaging 1.00
R1766:Scube1 UTSW 15 83721945 missense probably damaging 1.00
R1778:Scube1 UTSW 15 83610204 missense probably damaging 1.00
R2975:Scube1 UTSW 15 83659098 missense probably damaging 0.99
R4080:Scube1 UTSW 15 83608747 missense probably damaging 1.00
R4434:Scube1 UTSW 15 83721924 missense probably damaging 1.00
R5585:Scube1 UTSW 15 83676923 missense probably damaging 1.00
R5857:Scube1 UTSW 15 83607260 unclassified probably benign
R5977:Scube1 UTSW 15 83629488 missense probably damaging 1.00
R6054:Scube1 UTSW 15 83651676 missense probably benign 0.43
R6461:Scube1 UTSW 15 83612427 missense probably damaging 1.00
R6956:Scube1 UTSW 15 83721876 missense probably damaging 1.00
R6959:Scube1 UTSW 15 83629435 missense probably benign 0.42
X0022:Scube1 UTSW 15 83634669 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGCACATGCTTTGGCTCAGG -3'
(R):5'- TTGGATGCCAGCTTCCCCAAAC -3'

Sequencing Primer
(F):5'- GTTGGGAACTTGTCCCCAC -3'
(R):5'- GGCCTGGTAGAAACATCTCG -3'
Posted On2014-03-14