Incidental Mutation 'R1438:Rorb'
ID160816
Institutional Source Beutler Lab
Gene Symbol Rorb
Ensembl Gene ENSMUSG00000036192
Gene NameRAR-related orphan receptor beta
SynonymsNr1f2, Rorbeta, RZR-beta
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location18930605-19111196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18955053 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 367 (L367P)
Ref Sequence ENSEMBL: ENSMUSP00000108451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040153] [ENSMUST00000112828] [ENSMUST00000112832]
Predicted Effect probably damaging
Transcript: ENSMUST00000040153
AA Change: L378P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047597
Gene: ENSMUSG00000036192
AA Change: L378P

DomainStartEndE-ValueType
ZnF_C4 18 89 1.51e-39 SMART
coiled coil region 95 133 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HOLI 275 431 1.83e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112828
AA Change: L293P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108447
Gene: ENSMUSG00000036192
AA Change: L293P

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
HOLI 190 346 1.83e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112832
AA Change: L367P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108451
Gene: ENSMUSG00000036192
AA Change: L367P

DomainStartEndE-ValueType
ZnF_C4 7 78 1.51e-39 SMART
coiled coil region 84 122 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HOLI 264 420 1.83e-29 SMART
Meta Mutation Damage Score 0.822 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Rorb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18957328 nonsense probably null
IGL01576:Rorb APN 19 18957334 missense probably damaging 1.00
IGL02863:Rorb APN 19 18952253 missense probably benign 0.05
IGL02886:Rorb APN 19 18977579 critical splice donor site probably null
4-limb_clasper UTSW 19 18983351 missense probably damaging 1.00
dee-no UTSW 19 18955053 missense probably damaging 1.00
grasshopper UTSW 19 19110557 start codon destroyed probably null 0.45
IGL02988:Rorb UTSW 19 18937972 missense probably damaging 1.00
R0748:Rorb UTSW 19 18977800 missense probably damaging 0.97
R1087:Rorb UTSW 19 18960414 missense probably damaging 1.00
R1710:Rorb UTSW 19 18960501 missense probably damaging 1.00
R1846:Rorb UTSW 19 18955081 missense probably damaging 1.00
R1852:Rorb UTSW 19 18962083 missense probably damaging 1.00
R1972:Rorb UTSW 19 18952203 missense probably damaging 0.96
R3903:Rorb UTSW 19 18962099 missense probably damaging 0.99
R3978:Rorb UTSW 19 18937890 missense probably benign 0.00
R4497:Rorb UTSW 19 18977628 missense possibly damaging 0.95
R4982:Rorb UTSW 19 18977688 missense probably benign 0.05
R5602:Rorb UTSW 19 18977937 missense probably damaging 0.97
R5733:Rorb UTSW 19 18988107 missense probably damaging 1.00
R6267:Rorb UTSW 19 18977857 missense possibly damaging 0.88
R6455:Rorb UTSW 19 18960492 missense probably damaging 1.00
R6544:Rorb UTSW 19 18952250 missense possibly damaging 0.66
R6753:Rorb UTSW 19 18957247 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAAGCTACTTGCCTTTGCATTGTCC -3'
(R):5'- GTCACATGGAATCCACACTAGCCAG -3'

Sequencing Primer
(F):5'- GCCTTTGCATTGTCCAAAAATATC -3'
(R):5'- CCCCTGACTACGTACTTGATAATGAG -3'
Posted On2014-03-14