Incidental Mutation 'R1439:Rfwd3'
ID160848
Institutional Source Beutler Lab
Gene Symbol Rfwd3
Ensembl Gene ENSMUSG00000033596
Gene Namering finger and WD repeat domain 3
Synonyms
MMRRC Submission 039494-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R1439 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111270944-111300222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111278288 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 554 (Y554C)
Ref Sequence ENSEMBL: ENSMUSP00000043780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038739]
Predicted Effect probably damaging
Transcript: ENSMUST00000038739
AA Change: Y554C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043780
Gene: ENSMUSG00000033596
AA Change: Y554C

DomainStartEndE-ValueType
low complexity region 222 243 N/A INTRINSIC
RING 288 331 3.78e-5 SMART
coiled coil region 355 403 N/A INTRINSIC
WD40 486 526 1.38e-2 SMART
WD40 529 568 6.43e-3 SMART
Blast:WD40 683 730 2e-12 BLAST
Blast:WD40 733 772 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212958
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male fertility (possibly infertility), gonad atrophy, oligospermia, failure of follicular development, increased cellular sensitivity to MMC treatment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,843,186 N499S probably damaging Het
AI661453 C A 17: 47,466,662 probably benign Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Alkbh1 A G 12: 87,429,145 V289A probably damaging Het
Bnc2 C T 4: 84,276,068 E1035K probably benign Het
C1s2 T A 6: 124,630,167 probably benign Het
C530008M17Rik T C 5: 76,840,910 V36A probably damaging Het
Cabin1 A G 10: 75,656,806 I1885T probably damaging Het
Col22a1 A G 15: 71,952,377 probably benign Het
Cpne4 A T 9: 104,989,632 T248S probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Ddx10 T A 9: 53,240,487 K79N probably damaging Het
Dennd1a A C 2: 38,043,400 L131R probably damaging Het
Dnah9 T C 11: 65,874,132 Y3862C probably benign Het
Eif3e A G 15: 43,278,428 probably benign Het
Emsy T C 7: 98,600,841 probably benign Het
Ep400 A T 5: 110,685,478 D1959E unknown Het
Fpr-rs7 A G 17: 20,113,607 I207T probably benign Het
Fubp3 C A 2: 31,598,551 L140I probably damaging Het
Gas2l2 T C 11: 83,427,472 D137G probably damaging Het
Git1 G T 11: 77,506,418 R699L possibly damaging Het
Gnao1 T A 8: 93,963,437 F27L probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga6 T G 2: 71,834,034 Y505D probably damaging Het
Itgad A T 7: 128,183,006 T205S probably benign Het
Jakmip3 A T 7: 139,029,646 Y574F probably benign Het
Laptm5 G T 4: 130,926,209 probably benign Het
Mlana A T 19: 29,706,852 R71S probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Ncapd3 T A 9: 27,087,566 probably null Het
Nectin1 A G 9: 43,792,099 E218G possibly damaging Het
Nectin3 A T 16: 46,448,394 Y548* probably null Het
Nif3l1 T C 1: 58,447,943 F96S probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Obsl1 C A 1: 75,486,784 E1755* probably null Het
Olfr1198 T C 2: 88,746,834 E18G possibly damaging Het
Osbpl9 T C 4: 109,101,156 D74G probably damaging Het
Osgin1 T A 8: 119,443,113 probably null Het
Otogl A G 10: 107,779,252 Y1931H probably benign Het
Pmepa1 A G 2: 173,228,081 I227T probably benign Het
Pprc1 T A 19: 46,063,736 N564K possibly damaging Het
Prkaa1 T C 15: 5,164,744 F92S probably damaging Het
Ptprd A G 4: 76,066,200 F811L probably damaging Het
Rad54b A G 4: 11,606,152 K520R possibly damaging Het
Rbfox1 A G 16: 7,330,433 T269A possibly damaging Het
Rfx2 A T 17: 56,787,720 V208E probably damaging Het
Rgs22 G T 15: 36,025,793 probably benign Het
Rrbp1 A G 2: 143,955,112 probably null Het
Ryr2 C T 13: 11,714,503 probably benign Het
Sbno1 A G 5: 124,384,460 probably benign Het
Secisbp2 T C 13: 51,679,723 probably benign Het
Sgsm2 C A 11: 74,869,138 R58L probably benign Het
Slc25a36 A C 9: 97,093,073 probably benign Het
Spink4 A G 4: 40,929,121 T49A possibly damaging Het
Steap3 A T 1: 120,227,820 F470I probably damaging Het
Stk10 A G 11: 32,617,919 Q907R probably damaging Het
Tdrd5 A G 1: 156,277,487 V446A probably damaging Het
Tmem117 G A 15: 95,094,597 M379I probably benign Het
Trappc12 A G 12: 28,747,161 L124P possibly damaging Het
Trim9 G A 12: 70,251,093 H613Y probably damaging Het
Trio A G 15: 27,897,914 W371R probably damaging Het
Ulk4 G C 9: 121,266,258 H110D possibly damaging Het
Upb1 T C 10: 75,439,942 V387A probably benign Het
Utrn A T 10: 12,744,049 I284N possibly damaging Het
Vmn2r111 C A 17: 22,571,116 W303L probably benign Het
Vmn2r15 G T 5: 109,294,087 P160Q probably damaging Het
Wdtc1 A G 4: 133,301,807 S323P probably benign Het
Zfp846 T A 9: 20,594,097 C418S possibly damaging Het
Zfyve26 G T 12: 79,252,163 P441Q probably benign Het
Other mutations in Rfwd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Rfwd3 APN 8 111273075 missense possibly damaging 0.53
IGL02193:Rfwd3 APN 8 111273015 utr 3 prime probably benign
IGL02282:Rfwd3 APN 8 111293982 splice site probably benign
IGL02903:Rfwd3 APN 8 111278229 missense probably benign 0.00
PIT4468001:Rfwd3 UTSW 8 111282720 missense probably benign 0.19
R0254:Rfwd3 UTSW 8 111294023 missense probably benign
R0279:Rfwd3 UTSW 8 111282733 missense probably benign 0.00
R0531:Rfwd3 UTSW 8 111293989 critical splice donor site probably null
R1137:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1164:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1168:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1191:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1192:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1258:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1259:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1260:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1261:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1579:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1580:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1581:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1727:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1763:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1774:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1785:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R1786:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2059:Rfwd3 UTSW 8 111297495 missense probably benign 0.20
R2130:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2132:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2133:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2145:Rfwd3 UTSW 8 111282613 missense probably benign
R2174:Rfwd3 UTSW 8 111283343 missense probably damaging 0.98
R3897:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R4625:Rfwd3 UTSW 8 111276358 missense probably benign 0.01
R5121:Rfwd3 UTSW 8 111282753 splice site probably null
R5480:Rfwd3 UTSW 8 111273832 missense probably damaging 0.96
R5781:Rfwd3 UTSW 8 111273084 missense probably benign 0.02
R7417:Rfwd3 UTSW 8 111273069 missense probably benign 0.03
Z1088:Rfwd3 UTSW 8 111297606 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGACCTTAGATTGCTGGTCAACTGTG -3'
(R):5'- ACTAACTTGCATTGCTCTCTGTGACAA -3'

Sequencing Primer
(F):5'- GCTGGTCAACTGTGGATATGC -3'
(R):5'- GCATTGCTCTCTGTGACAATTAAC -3'
Posted On2014-03-14