Incidental Mutation 'R1441:Ankrd16'
ID160982
Institutional Source Beutler Lab
Gene Symbol Ankrd16
Ensembl Gene ENSMUSG00000047909
Gene Nameankyrin repeat domain 16
Synonyms2810455F06Rik, D430029B21Rik
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location11777876-11790329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11778746 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 53 (L53P)
Ref Sequence ENSEMBL: ENSMUSP00000115525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056108] [ENSMUST00000071564] [ENSMUST00000130186] [ENSMUST00000133664] [ENSMUST00000156067]
Predicted Effect probably damaging
Transcript: ENSMUST00000056108
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052056
Gene: ENSMUSG00000047909
AA Change: L53P

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 167 1.74e0 SMART
ANK 170 200 7.71e-2 SMART
ANK 204 233 5.01e-1 SMART
ANK 238 268 1.37e2 SMART
ANK 273 302 7.53e-5 SMART
ANK 306 336 4.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071564
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126543
Predicted Effect probably damaging
Transcript: ENSMUST00000130186
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141685
Gene: ENSMUSG00000047909
AA Change: L53P

DomainStartEndE-ValueType
ANK 36 66 7.2e-3 SMART
Pfam:Ank 72 90 7.9e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133664
SMART Domains Protein: ENSMUSP00000115226
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
Pfam:Ank 1 29 1.5e-3 PFAM
Pfam:Ank_4 1 51 7.3e-11 PFAM
Pfam:Ank_2 1 56 8.9e-11 PFAM
Pfam:Ank_5 18 56 1.8e-6 PFAM
Pfam:Ank 30 55 3e-5 PFAM
Pfam:Ank_3 30 55 2.7e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151402
Predicted Effect probably damaging
Transcript: ENSMUST00000156067
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115525
Gene: ENSMUSG00000047909
AA Change: L53P

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 165 9.46e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194100
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Ankrd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Ankrd16 APN 2 11778662 missense probably damaging 1.00
R0280:Ankrd16 UTSW 2 11781501 missense probably damaging 1.00
R0521:Ankrd16 UTSW 2 11789881 missense probably benign
R1699:Ankrd16 UTSW 2 11784393 missense probably benign
R1858:Ankrd16 UTSW 2 11778596 missense probably benign
R1944:Ankrd16 UTSW 2 11783632 splice site probably null
R2074:Ankrd16 UTSW 2 11789748 missense possibly damaging 0.82
R2104:Ankrd16 UTSW 2 11779900 intron probably benign
R2131:Ankrd16 UTSW 2 11783695 missense probably damaging 1.00
R3847:Ankrd16 UTSW 2 11789808 missense probably benign 0.04
R3940:Ankrd16 UTSW 2 11784381 missense probably benign
R4424:Ankrd16 UTSW 2 11784404 missense possibly damaging 0.95
R4707:Ankrd16 UTSW 2 11778797 missense probably damaging 1.00
R4863:Ankrd16 UTSW 2 11784316 missense probably benign 0.05
R5026:Ankrd16 UTSW 2 11789881 missense probably benign 0.05
R5079:Ankrd16 UTSW 2 11778899 missense probably damaging 1.00
R5251:Ankrd16 UTSW 2 11778741 missense probably damaging 1.00
R5304:Ankrd16 UTSW 2 11789734 missense probably benign
R5746:Ankrd16 UTSW 2 11784367 missense probably damaging 0.99
R6932:Ankrd16 UTSW 2 11786243 missense possibly damaging 0.90
R6958:Ankrd16 UTSW 2 11779793 missense probably damaging 1.00
Z1088:Ankrd16 UTSW 2 11779818 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCGGTAACCAGAATGACCTACGAG -3'
(R):5'- TCTTCAAGGAGTCCACGACTGCAC -3'

Sequencing Primer
(F):5'- GATCTGCTCTAAGACTGAACCTGG -3'
(R):5'- CCACGACTGCACCTCGG -3'
Posted On2014-03-14