Incidental Mutation 'R1441:Rbks'
ID160999
Institutional Source Beutler Lab
Gene Symbol Rbks
Ensembl Gene ENSMUSG00000029136
Gene Nameribokinase
Synonyms
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31624439-31697627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31659997 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 143 (V143I)
Ref Sequence ENSEMBL: ENSMUSP00000031018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000201910]
Predicted Effect probably benign
Transcript: ENSMUST00000031018
AA Change: V143I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136
AA Change: V143I

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201719
Predicted Effect probably benign
Transcript: ENSMUST00000201910
SMART Domains Protein: ENSMUSP00000144669
Gene: ENSMUSG00000106918

DomainStartEndE-ValueType
PDB:4CE4|6 1 49 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202690
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Rbks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Rbks APN 5 31660017 missense probably damaging 1.00
IGL02618:Rbks APN 5 31624519 nonsense probably null
IGL02678:Rbks APN 5 31673413 missense probably damaging 1.00
IGL02719:Rbks APN 5 31651801 intron probably benign
IGL02947:Rbks APN 5 31660063 missense probably benign
R0334:Rbks UTSW 5 31624519 nonsense probably null
R2568:Rbks UTSW 5 31665752 missense probably damaging 0.99
R4545:Rbks UTSW 5 31624568 missense probably benign 0.10
R4546:Rbks UTSW 5 31624568 missense probably benign 0.10
R4591:Rbks UTSW 5 31660008 missense possibly damaging 0.52
R4833:Rbks UTSW 5 31624515 missense probably benign 0.00
R4967:Rbks UTSW 5 31624532 missense probably damaging 1.00
R5076:Rbks UTSW 5 31650451 nonsense probably null
R5214:Rbks UTSW 5 31650392 intron probably benign
R6051:Rbks UTSW 5 31651819 missense probably damaging 1.00
R6194:Rbks UTSW 5 31666890 missense probably benign 0.05
R6607:Rbks UTSW 5 31647792 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCGGTGAATCTCACAGATGGAGGAA -3'
(R):5'- AAACCGGAATGTCCTGGAAATGTTAAGA -3'

Sequencing Primer
(F):5'- CACAGATGGAGGAACGAATATTTTAC -3'
(R):5'- CATCCTTAGATTGGCTTTGCTTGG -3'
Posted On2014-03-14