Incidental Mutation 'R1441:Ccser1'
ID161005
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Namecoiled-coil serine rich 1
Synonyms6230405M12Rik, C130092O11Rik, Fam190a
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location61180324-62382865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62380032 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 818 (T818I)
Ref Sequence ENSEMBL: ENSMUSP00000122894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214] [ENSMUST00000232648]
Predicted Effect probably benign
Transcript: ENSMUST00000045522
AA Change: T818I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: T818I

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126214
AA Change: T818I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: T818I

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232648
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62380142 missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61810665 nonsense probably null
IGL01012:Ccser1 APN 6 61638490 missense probably benign 0.01
IGL01391:Ccser1 APN 6 61638521 splice site probably benign
IGL01643:Ccser1 APN 6 61311855 missense probably benign 0.01
IGL01767:Ccser1 APN 6 61718152 missense probably benign 0.03
IGL02081:Ccser1 APN 6 61311168 nonsense probably null
IGL02152:Ccser1 APN 6 61311708 missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61311292 missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62379831 missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R0020:Ccser1 UTSW 6 61313804 missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61423061 missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62380106 missense probably damaging 0.99
R1650:Ccser1 UTSW 6 61638490 missense probably benign 0.01
R1653:Ccser1 UTSW 6 61311465 missense probably benign 0.00
R1913:Ccser1 UTSW 6 62379894 missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61313646 splice site probably benign
R2030:Ccser1 UTSW 6 61311563 missense probably benign
R2056:Ccser1 UTSW 6 61422952 splice site probably null
R2268:Ccser1 UTSW 6 61570843 missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61422960 missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61311584 missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61311926 missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61311501 missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61718191 missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61311366 missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R5221:Ccser1 UTSW 6 61312091 missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61311666 missense probably benign 0.00
R5604:Ccser1 UTSW 6 61313804 missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61311276 missense probably benign 0.00
R5970:Ccser1 UTSW 6 61311242 missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 61373962 missense probably damaging 0.96
R6257:Ccser1 UTSW 6 62379785 missense probably benign
R6375:Ccser1 UTSW 6 61311168 nonsense probably null
R6703:Ccser1 UTSW 6 61638511 nonsense probably null
R6930:Ccser1 UTSW 6 62380025 missense probably benign 0.03
R7256:Ccser1 UTSW 6 61311867 missense probably benign 0.38
R7362:Ccser1 UTSW 6 61810880 missense unknown
R7508:Ccser1 UTSW 6 61570723 missense probably benign 0.05
R7532:Ccser1 UTSW 6 62379931 nonsense probably null
R7533:Ccser1 UTSW 6 61638490 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TACTCCCACCGAGGACCGTTTTAG -3'
(R):5'- TGGGCATGACCACTCTTAGGTGAC -3'

Sequencing Primer
(F):5'- CACCGAGGACCGTTTTAGATATTC -3'
(R):5'- GACCACTCTTAGGTGACACATGG -3'
Posted On2014-03-14