Incidental Mutation 'R1441:Vmn2r58'
ID161008
Institutional Source Beutler Lab
Gene Symbol Vmn2r58
Ensembl Gene ENSMUSG00000090383
Gene Namevomeronasal 2, receptor 58
SynonymsEG628422
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41836881-41872670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41837440 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 677 (T677I)
Ref Sequence ENSEMBL: ENSMUSP00000126966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171671]
Predicted Effect probably damaging
Transcript: ENSMUST00000171671
AA Change: T677I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126966
Gene: ENSMUSG00000090383
AA Change: T677I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 8e-43 PFAM
Pfam:NCD3G 514 567 1.8e-23 PFAM
Pfam:7tm_3 597 835 2.9e-52 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Other mutations in Vmn2r58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn2r58 APN 7 41864430 missense possibly damaging 0.53
IGL00924:Vmn2r58 APN 7 41837467 missense probably damaging 1.00
IGL01291:Vmn2r58 APN 7 41864511 missense probably benign 0.02
IGL01480:Vmn2r58 APN 7 41864692 missense probably benign 0.01
IGL01551:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL01591:Vmn2r58 APN 7 41865329 missense probably benign 0.03
IGL01940:Vmn2r58 APN 7 41837647 missense probably benign 0.00
IGL01994:Vmn2r58 APN 7 41836970 missense probably damaging 0.98
IGL02041:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL02222:Vmn2r58 APN 7 41864025 missense possibly damaging 0.81
IGL02317:Vmn2r58 APN 7 41837341 missense possibly damaging 0.89
IGL02614:Vmn2r58 APN 7 41837129 missense probably damaging 1.00
IGL02673:Vmn2r58 APN 7 41864658 missense possibly damaging 0.90
IGL03323:Vmn2r58 APN 7 41861871 missense probably benign 0.06
IGL03337:Vmn2r58 APN 7 41864386 missense possibly damaging 0.93
IGL03380:Vmn2r58 APN 7 41864450 missense probably benign 0.00
ANU05:Vmn2r58 UTSW 7 41864511 missense probably benign 0.02
R0138:Vmn2r58 UTSW 7 41837624 missense probably damaging 1.00
R0141:Vmn2r58 UTSW 7 41861885 missense probably benign 0.11
R0421:Vmn2r58 UTSW 7 41865204 missense probably benign 0.02
R0604:Vmn2r58 UTSW 7 41860576 missense possibly damaging 0.78
R0854:Vmn2r58 UTSW 7 41837138 missense probably damaging 1.00
R1413:Vmn2r58 UTSW 7 41863963 missense probably benign 0.01
R1678:Vmn2r58 UTSW 7 41864056 missense probably benign 0.40
R1691:Vmn2r58 UTSW 7 41837489 missense possibly damaging 0.95
R1699:Vmn2r58 UTSW 7 41860527 missense probably benign
R1865:Vmn2r58 UTSW 7 41837258 missense possibly damaging 0.95
R2008:Vmn2r58 UTSW 7 41860500 missense probably damaging 1.00
R2036:Vmn2r58 UTSW 7 41863993 missense probably benign
R2202:Vmn2r58 UTSW 7 41864170 missense probably benign 0.07
R3787:Vmn2r58 UTSW 7 41864074 missense probably benign 0.01
R3883:Vmn2r58 UTSW 7 41864490 nonsense probably null
R3944:Vmn2r58 UTSW 7 41864461 missense probably benign 0.03
R3949:Vmn2r58 UTSW 7 41863924 missense probably benign 0.08
R4232:Vmn2r58 UTSW 7 41837587 missense possibly damaging 0.91
R4409:Vmn2r58 UTSW 7 41872627 missense possibly damaging 0.69
R4411:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4413:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4600:Vmn2r58 UTSW 7 41872622 missense probably benign 0.03
R4610:Vmn2r58 UTSW 7 41837693 missense probably benign
R4646:Vmn2r58 UTSW 7 41860511 missense probably damaging 0.96
R4793:Vmn2r58 UTSW 7 41865071 missense probably damaging 0.99
R4870:Vmn2r58 UTSW 7 41837215 missense possibly damaging 0.76
R4981:Vmn2r58 UTSW 7 41837461 missense probably damaging 1.00
R4993:Vmn2r58 UTSW 7 41837752 missense probably benign 0.00
R5024:Vmn2r58 UTSW 7 41864322 missense probably damaging 0.99
R5064:Vmn2r58 UTSW 7 41837110 missense probably damaging 0.99
R5330:Vmn2r58 UTSW 7 41863960 nonsense probably null
R5526:Vmn2r58 UTSW 7 41872645 missense probably benign 0.01
R5980:Vmn2r58 UTSW 7 41865056 missense possibly damaging 0.81
R6163:Vmn2r58 UTSW 7 41837401 missense probably benign 0.31
R6365:Vmn2r58 UTSW 7 41864183 missense probably benign 0.42
R6567:Vmn2r58 UTSW 7 41865249 missense probably benign 0.34
R6594:Vmn2r58 UTSW 7 41837111 missense possibly damaging 0.69
R6980:Vmn2r58 UTSW 7 41864238 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCCCAGTACAGTGTGGAAGGCAAC -3'
(R):5'- CGTCAAGGCCAATAACAGGACTCTC -3'

Sequencing Primer
(F):5'- AACTGTTGAACCCATGTTGC -3'
(R):5'- AGGACTCTCAGTTACATCCTGC -3'
Posted On2014-03-14