Incidental Mutation 'R1441:Eepd1'
ID161014
Institutional Source Beutler Lab
Gene Symbol Eepd1
Ensembl Gene ENSMUSG00000036611
Gene Nameendonuclease/exonuclease/phosphatase family domain containing 1
Synonyms
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location25481547-25604110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25483203 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 254 (M254I)
Ref Sequence ENSEMBL: ENSMUSP00000047083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040677]
Predicted Effect probably benign
Transcript: ENSMUST00000040677
AA Change: M254I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047083
Gene: ENSMUSG00000036611
AA Change: M254I

DomainStartEndE-ValueType
HhH1 48 67 1.45e-1 SMART
HhH1 78 97 2.55e2 SMART
low complexity region 124 135 N/A INTRINSIC
HhH1 145 164 6.66e-1 SMART
Pfam:Exo_endo_phos 264 535 6.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156237
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Eepd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Eepd1 APN 9 25482482 missense probably damaging 1.00
IGL02110:Eepd1 APN 9 25603402 splice site probably benign
IGL02113:Eepd1 APN 9 25482713 missense probably damaging 1.00
IGL02188:Eepd1 APN 9 25581892 missense probably benign 0.01
IGL02930:Eepd1 APN 9 25483240 missense probably damaging 0.96
IGL03293:Eepd1 APN 9 25603412 missense possibly damaging 0.90
IGL03046:Eepd1 UTSW 9 25482685 missense probably damaging 1.00
R0970:Eepd1 UTSW 9 25603426 missense probably damaging 1.00
R1037:Eepd1 UTSW 9 25586783 missense possibly damaging 0.94
R1835:Eepd1 UTSW 9 25482868 missense possibly damaging 0.84
R3912:Eepd1 UTSW 9 25483304 missense probably damaging 1.00
R4245:Eepd1 UTSW 9 25594624 missense probably benign 0.00
R4704:Eepd1 UTSW 9 25482826 missense probably benign
R4838:Eepd1 UTSW 9 25589460 missense possibly damaging 0.56
R5153:Eepd1 UTSW 9 25586753 missense probably benign 0.37
R5634:Eepd1 UTSW 9 25603553 missense probably benign 0.12
R5994:Eepd1 UTSW 9 25603453 missense probably damaging 1.00
R6141:Eepd1 UTSW 9 25482984 missense probably benign 0.00
R6709:Eepd1 UTSW 9 25482868 missense probably benign 0.26
R7063:Eepd1 UTSW 9 25483036 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCAGCCTTCCTGGACAGAATAAGAC -3'
(R):5'- GCTTTCGGCAATCAGCTCTGGAAC -3'

Sequencing Primer
(F):5'- TAAGACACCAGGTGTTCGC -3'
(R):5'- GGAACACGGATTAAGCACTCTTTC -3'
Posted On2014-03-14