Incidental Mutation 'R1441:Olfr893'
ID161016
Institutional Source Beutler Lab
Gene Symbol Olfr893
Ensembl Gene ENSMUSG00000093901
Gene Nameolfactory receptor 893
SynonymsGA_x6K02T2PVTD-31889215-31890153, MOR170-11
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38208365-38211598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38209481 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 141 (C141R)
Ref Sequence ENSEMBL: ENSMUSP00000148719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093867] [ENSMUST00000211975]
Predicted Effect probably damaging
Transcript: ENSMUST00000093867
AA Change: C143R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091390
Gene: ENSMUSG00000093901
AA Change: C143R

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.2e-45 PFAM
Pfam:7tm_1 43 292 8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211975
AA Change: C141R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000212815
AA Change: C90R
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Olfr893
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Olfr893 APN 9 38209238 missense probably damaging 1.00
IGL00914:Olfr893 APN 9 38209799 intron probably null
IGL01563:Olfr893 APN 9 38209701 missense probably damaging 1.00
IGL01696:Olfr893 APN 9 38209049 unclassified probably benign
IGL02064:Olfr893 APN 9 38209578 missense probably damaging 1.00
IGL02605:Olfr893 APN 9 38209236 missense probably damaging 0.99
R0415:Olfr893 UTSW 9 38209973 missense probably benign
R0463:Olfr893 UTSW 9 38209064 missense probably benign 0.00
R0843:Olfr893 UTSW 9 38209283 missense possibly damaging 0.81
R1939:Olfr893 UTSW 9 38209429 nonsense probably null
R2512:Olfr893 UTSW 9 38209374 missense probably damaging 1.00
R4890:Olfr893 UTSW 9 38209290 missense probably benign 0.00
R5439:Olfr893 UTSW 9 38209754 missense probably benign 0.00
R6918:Olfr893 UTSW 9 38209652 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCTGAGTTACGGCTGCCTTTG -3'
(R):5'- TCAGCGGATGCTGGTTTGACATAAG -3'

Sequencing Primer
(F):5'- ATTATACAGCTACCGTGATGGG -3'
(R):5'- CCTGTAGCTGATGACATCTGAAC -3'
Posted On2014-03-14