Incidental Mutation 'R1441:Impdh2'
ID161017
Institutional Source Beutler Lab
Gene Symbol Impdh2
Ensembl Gene ENSMUSG00000062867
Gene Nameinosine monophosphate dehydrogenase 2
SynonymsIMP dehydrogenase type II
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108560286-108565584 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108564776 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 201 (T201K)
Ref Sequence ENSEMBL: ENSMUSP00000142305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006851] [ENSMUST00000074208] [ENSMUST00000081111] [ENSMUST00000112155] [ENSMUST00000193421] [ENSMUST00000194381] [ENSMUST00000194904]
Predicted Effect probably benign
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081111
AA Change: T383K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867
AA Change: T383K

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083645
Predicted Effect probably benign
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193242
Predicted Effect probably benign
Transcript: ENSMUST00000193421
SMART Domains Protein: ENSMUSP00000142117
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 248 1.3e-18 SMART
CBS 92 143 4.5e-9 SMART
CBS 159 207 7.6e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194365
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194689
Predicted Effect probably benign
Transcript: ENSMUST00000194904
AA Change: T201K

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867
AA Change: T201K

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196210
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities resulting in embryonic lethality around the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Impdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0032:Impdh2 UTSW 9 108561661 missense probably damaging 1.00
R0523:Impdh2 UTSW 9 108561819 unclassified probably null
R0523:Impdh2 UTSW 9 108561820 missense possibly damaging 0.80
R0644:Impdh2 UTSW 9 108563637 missense possibly damaging 0.56
R0648:Impdh2 UTSW 9 108563466 missense probably benign 0.01
R0905:Impdh2 UTSW 9 108561097 unclassified probably benign
R1173:Impdh2 UTSW 9 108561829 missense probably benign 0.19
R1202:Impdh2 UTSW 9 108563187 missense probably damaging 1.00
R1818:Impdh2 UTSW 9 108563212 unclassified probably null
R2141:Impdh2 UTSW 9 108565347 missense possibly damaging 0.50
R2173:Impdh2 UTSW 9 108565394 splice site probably null
R2438:Impdh2 UTSW 9 108560616 missense probably benign 0.06
R4061:Impdh2 UTSW 9 108562804 missense possibly damaging 0.46
R4273:Impdh2 UTSW 9 108564956 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108564671 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108565515 missense probably benign 0.00
R5073:Impdh2 UTSW 9 108563336 critical splice donor site probably null
R5896:Impdh2 UTSW 9 108563966 missense probably benign 0.06
R6315:Impdh2 UTSW 9 108563439 missense possibly damaging 0.66
X0066:Impdh2 UTSW 9 108561787 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TACATGCACGAGCACATGCAGAGG -3'
(R):5'- TCCCATCTGAGAAGAAGTACTCGCC -3'

Sequencing Primer
(F):5'- GTACTATTTCAGGCAGATAGGTAGC -3'
(R):5'- AGAAGTACTCGCCAGGGG -3'
Posted On2014-03-14