Incidental Mutation 'R1441:Rasa1'
ID 161028
Institutional Source Beutler Lab
Gene Symbol Rasa1
Ensembl Gene ENSMUSG00000021549
Gene Name RAS p21 protein activator 1
Synonyms Gap, p120-rasGAP
MMRRC Submission 039496-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1441 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 85362899-85437249 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 85400540 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109552]
AlphaFold E9PYG6
Predicted Effect probably null
Transcript: ENSMUST00000109552
SMART Domains Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 37 106 N/A INTRINSIC
low complexity region 119 142 N/A INTRINSIC
SH2 170 253 9.44e-29 SMART
SH3 273 331 1.7e-10 SMART
SH2 340 423 7.44e-27 SMART
PH 466 570 5.11e-20 SMART
C2 586 680 6.9e-10 SMART
RasGAP 689 1035 2.77e-156 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132711
Predicted Effect probably benign
Transcript: ENSMUST00000223598
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 114,481,194 (GRCm39) probably null Het
Ankrd16 T C 2: 11,783,557 (GRCm39) L53P probably damaging Het
Arsk A T 13: 76,223,083 (GRCm39) N171K probably benign Het
Brwd1 A C 16: 95,867,351 (GRCm39) C161W probably damaging Het
Card9 T C 2: 26,249,402 (GRCm39) N53S probably benign Het
Ccdc13 A T 9: 121,642,515 (GRCm39) V403E probably benign Het
Ccdc83 T A 7: 89,893,351 (GRCm39) E135D probably damaging Het
Ccser1 C T 6: 62,357,016 (GRCm39) T818I probably benign Het
Cd44 T A 2: 102,676,763 (GRCm39) T301S probably damaging Het
Eepd1 G A 9: 25,394,499 (GRCm39) M254I probably benign Het
Ephb4 C T 5: 137,359,509 (GRCm39) R360C probably damaging Het
Fam149a G T 8: 45,808,684 (GRCm39) Q150K probably damaging Het
G6pc2 G A 2: 69,051,198 (GRCm39) C97Y probably damaging Het
Gcsam T A 16: 45,433,401 (GRCm39) M15K probably benign Het
Impdh2 C A 9: 108,441,975 (GRCm39) T201K probably benign Het
Kdm2b C T 5: 123,070,943 (GRCm39) E379K probably benign Het
Mcm3ap T C 10: 76,307,000 (GRCm39) V371A probably benign Het
Mink1 T A 11: 70,497,940 (GRCm39) N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 (GRCm39) P330L probably damaging Het
Mroh2a A G 1: 88,169,353 (GRCm39) D676G possibly damaging Het
Myo1a C T 10: 127,555,148 (GRCm39) P838L probably benign Het
Naip5 T C 13: 100,356,225 (GRCm39) H1130R possibly damaging Het
Ninl C A 2: 150,813,044 (GRCm39) G204V probably benign Het
Or12k5 C A 2: 36,895,131 (GRCm39) R165L possibly damaging Het
Or2a54 T C 6: 43,092,880 (GRCm39) V68A probably benign Het
Or4k51 T C 2: 111,585,347 (GRCm39) F251S probably damaging Het
Or5ac20 G A 16: 59,104,228 (GRCm39) L211F probably benign Het
Or5an11 T A 19: 12,245,750 (GRCm39) L52* probably null Het
Or8c15 T C 9: 38,120,777 (GRCm39) C141R probably damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pip4p2 A T 4: 14,892,477 (GRCm39) I114L possibly damaging Het
Ptpn22 G T 3: 103,781,563 (GRCm39) W114L probably damaging Het
Rbks C T 5: 31,817,341 (GRCm39) V143I probably benign Het
Rbm19 T C 5: 120,269,241 (GRCm39) F515L probably damaging Het
Ror1 A G 4: 100,298,180 (GRCm39) T518A probably benign Het
Rpusd4 C A 9: 35,184,065 (GRCm39) A240E probably damaging Het
Rufy3 T C 5: 88,780,374 (GRCm39) L374P probably damaging Het
Sf3a3 T C 4: 124,618,935 (GRCm39) S299P probably damaging Het
Slc7a12 T G 3: 14,562,414 (GRCm39) S264A possibly damaging Het
Tasor T A 14: 27,186,217 (GRCm39) C805* probably null Het
Tm9sf1 T C 14: 55,873,782 (GRCm39) Y572C probably damaging Het
Tpcn2 G A 7: 144,813,871 (GRCm39) S475L probably benign Het
Trim17 A G 11: 58,856,018 (GRCm39) D25G probably damaging Het
Ttn T A 2: 76,572,121 (GRCm39) K26257N probably damaging Het
Txndc11 C A 16: 10,952,414 (GRCm39) probably benign Het
Utrn A G 10: 12,559,039 (GRCm39) S1405P probably damaging Het
Vmn2r58 G A 7: 41,486,864 (GRCm39) T677I probably damaging Het
Other mutations in Rasa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Rasa1 APN 13 85,436,548 (GRCm39) missense probably benign 0.02
IGL01396:Rasa1 APN 13 85,406,561 (GRCm39) missense probably benign 0.10
IGL01670:Rasa1 APN 13 85,373,609 (GRCm39) missense probably damaging 0.97
IGL02095:Rasa1 APN 13 85,364,274 (GRCm39) missense probably benign 0.10
IGL02822:Rasa1 APN 13 85,400,633 (GRCm39) missense probably damaging 0.97
IGL03126:Rasa1 APN 13 85,404,515 (GRCm39) missense possibly damaging 0.94
F5770:Rasa1 UTSW 13 85,375,064 (GRCm39) splice site probably null
PIT4458001:Rasa1 UTSW 13 85,375,237 (GRCm39) missense possibly damaging 0.91
R1393:Rasa1 UTSW 13 85,371,641 (GRCm39) missense probably damaging 1.00
R1907:Rasa1 UTSW 13 85,374,691 (GRCm39) nonsense probably null
R4243:Rasa1 UTSW 13 85,392,314 (GRCm39) missense probably damaging 1.00
R4593:Rasa1 UTSW 13 85,386,340 (GRCm39) splice site probably null
R4687:Rasa1 UTSW 13 85,374,754 (GRCm39) missense possibly damaging 0.89
R4689:Rasa1 UTSW 13 85,386,282 (GRCm39) nonsense probably null
R4753:Rasa1 UTSW 13 85,436,509 (GRCm39) splice site probably null
R4758:Rasa1 UTSW 13 85,382,567 (GRCm39) missense probably benign
R4774:Rasa1 UTSW 13 85,398,621 (GRCm39) intron probably benign
R5363:Rasa1 UTSW 13 85,436,674 (GRCm39) missense possibly damaging 0.86
R5375:Rasa1 UTSW 13 85,437,022 (GRCm39) intron probably benign
R6134:Rasa1 UTSW 13 85,374,745 (GRCm39) missense probably benign 0.01
R6190:Rasa1 UTSW 13 85,381,814 (GRCm39) missense probably benign 0.02
R6755:Rasa1 UTSW 13 85,374,717 (GRCm39) missense possibly damaging 0.49
R7564:Rasa1 UTSW 13 85,376,827 (GRCm39) missense probably benign 0.09
R7862:Rasa1 UTSW 13 85,403,530 (GRCm39) missense probably damaging 0.99
R9138:Rasa1 UTSW 13 85,369,635 (GRCm39) missense possibly damaging 0.93
R9280:Rasa1 UTSW 13 85,436,732 (GRCm39) missense unknown
R9328:Rasa1 UTSW 13 85,403,575 (GRCm39) critical splice acceptor site probably null
R9340:Rasa1 UTSW 13 85,369,649 (GRCm39) missense probably damaging 0.98
R9648:Rasa1 UTSW 13 85,436,690 (GRCm39) missense possibly damaging 0.73
RF016:Rasa1 UTSW 13 85,371,607 (GRCm39) missense possibly damaging 0.65
X0023:Rasa1 UTSW 13 85,381,853 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGAAAGCCATTCTATTCTACCACAC -3'
(R):5'- ACTGTCTTCAGTTTCACAAACAAAGATGCTA -3'

Sequencing Primer
(F):5'- GCATTTGATGAATTTAAGCATTTGAC -3'
(R):5'- GATGCTAGAAACAGCATAGAACTTTG -3'
Posted On 2014-03-14