Incidental Mutation 'R1441:Fam208a'
ID161030
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission 039496-MU
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 27464260 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 805 (C805*)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably null
Transcript: ENSMUST00000022450
AA Change: C805*
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: C805*

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223688
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTAACTTGAGAGTGCAGCAGGAAG -3'
(R):5'- ACGAAACAGCCAGGATCTCTAGGAC -3'

Sequencing Primer
(F):5'- TGCAGCAGGAAGATTCCG -3'
(R):5'- CTTTTGGGAAGGAAAATGCACTCC -3'
Posted On2014-03-14