Incidental Mutation 'R1441:Tm9sf1'
ID161031
Institutional Source Beutler Lab
Gene Symbol Tm9sf1
Ensembl Gene ENSMUSG00000002320
Gene Nametransmembrane 9 superfamily member 1
Synonyms1200014D02Rik, MP70
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55635965-55643806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55636325 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 572 (Y572C)
Ref Sequence ENSEMBL: ENSMUSP00000113782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000047131] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000125133] [ENSMUST00000132338] [ENSMUST00000135221] [ENSMUST00000148351] [ENSMUST00000149726]
Predicted Effect probably damaging
Transcript: ENSMUST00000002391
AA Change: Y572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320
AA Change: Y572C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120041
AA Change: Y572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320
AA Change: Y572C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121791
AA Change: Y572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320
AA Change: Y572C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121937
AA Change: Y555C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320
AA Change: Y555C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122358
AA Change: Y572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320
AA Change: Y572C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130167
Predicted Effect probably benign
Transcript: ENSMUST00000132338
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146588
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect probably benign
Transcript: ENSMUST00000149726
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect unknown
Transcript: ENSMUST00000156420
AA Change: Y108C
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Tm9sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Tm9sf1 APN 14 55642727 missense probably damaging 1.00
IGL01102:Tm9sf1 APN 14 55642767 missense probably damaging 1.00
IGL02263:Tm9sf1 APN 14 55642935 missense possibly damaging 0.95
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0469:Tm9sf1 UTSW 14 55641429 missense possibly damaging 0.87
R0928:Tm9sf1 UTSW 14 55636457 missense probably damaging 1.00
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0974:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R1644:Tm9sf1 UTSW 14 55641300 missense probably benign 0.03
R1873:Tm9sf1 UTSW 14 55636223 missense probably damaging 1.00
R2176:Tm9sf1 UTSW 14 55641409 missense possibly damaging 0.89
R2973:Tm9sf1 UTSW 14 55641114 missense probably benign 0.01
R4284:Tm9sf1 UTSW 14 55641323 missense probably damaging 1.00
R4545:Tm9sf1 UTSW 14 55638108 missense possibly damaging 0.74
R4633:Tm9sf1 UTSW 14 55641203 missense probably damaging 1.00
R4816:Tm9sf1 UTSW 14 55641149 missense possibly damaging 0.89
R4943:Tm9sf1 UTSW 14 55641168 missense probably damaging 0.99
R5270:Tm9sf1 UTSW 14 55636481 missense probably damaging 1.00
R5384:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5385:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5386:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5561:Tm9sf1 UTSW 14 55638097 missense probably damaging 1.00
R6246:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6247:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6248:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
X0025:Tm9sf1 UTSW 14 55642836 missense probably benign 0.43
X0026:Tm9sf1 UTSW 14 55642937 start codon destroyed probably null 0.92
Predicted Primers PCR Primer
(F):5'- TGCCATCACACAATTCGGTCAGAAG -3'
(R):5'- ACATCTTTGCCACAGTCTGGGGTC -3'

Sequencing Primer
(F):5'- TTCGGTCAGAAGAGAAGCTATC -3'
(R):5'- GTCGAGAGCAGTACACTCTG -3'
Posted On2014-03-14