Incidental Mutation 'R1452:Eif3m'
ID161052
Institutional Source Beutler Lab
Gene Symbol Eif3m
Ensembl Gene ENSMUSG00000027170
Gene Nameeukaryotic translation initiation factor 3, subunit M
SynonymsGa17, Pcid1, Tango7
MMRRC Submission 039507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1452 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104999656-105017080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105006777 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 199 (Q199L)
Ref Sequence ENSEMBL: ENSMUSP00000028592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028592] [ENSMUST00000111110] [ENSMUST00000148476]
Predicted Effect probably damaging
Transcript: ENSMUST00000028592
AA Change: Q199L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028592
Gene: ENSMUSG00000027170
AA Change: Q199L

DomainStartEndE-ValueType
Blast:HDc 119 209 1e-12 BLAST
PINT 268 357 6.42e-26 SMART
low complexity region 358 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111110
AA Change: Q67L

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106739
Gene: ENSMUSG00000027170
AA Change: Q67L

DomainStartEndE-ValueType
Blast:HDc 13 77 7e-8 BLAST
PINT 136 225 6.42e-26 SMART
low complexity region 226 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131266
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148476
AA Change: Q16L

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122339
Gene: ENSMUSG00000027170
AA Change: Q16L

DomainStartEndE-ValueType
Blast:PINT 84 126 7e-25 BLAST
low complexity region 127 141 N/A INTRINSIC
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the eurkaryotic translation initiation factor 3 complete (eIF-3) required for protein synthesis. Elevated levels of the encoded protein are present in cancer cell lines. Inactivation of the encoded protein has been shown to interfere with translation of herpes virus mRNAs by preventing the association of mRNAs with the ribosomes. A pseudogene of this gene is located on the X chromosome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit decreased body weight and altered organ weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,939 Y415C probably damaging Het
2810474O19Rik A T 6: 149,326,632 K392I probably damaging Het
A2m A G 6: 121,678,056 I1446M probably benign Het
Acaca T A 11: 84,295,059 probably benign Het
Adgre4 A T 17: 55,784,996 E85D probably benign Het
Akt3 A T 1: 177,131,067 Y26N possibly damaging Het
Arl15 T C 13: 113,967,783 V132A probably benign Het
Atp6v1h A G 1: 5,098,137 probably benign Het
Atrip T A 9: 109,072,659 D110V probably damaging Het
Bahcc1 T G 11: 120,282,239 probably benign Het
Cd53 C T 3: 106,768,959 G31S probably damaging Het
Cdk14 T C 5: 4,888,927 S404G possibly damaging Het
Cers3 A T 7: 66,783,404 K156N probably damaging Het
Colgalt2 C A 1: 152,504,153 L448M probably damaging Het
Cox15 G T 19: 43,746,905 T141K probably damaging Het
Csnk2a2 C T 8: 95,457,375 probably benign Het
Cyp2b10 A T 7: 25,925,388 probably benign Het
Cyp2c55 A G 19: 39,011,090 Y80C probably damaging Het
Depdc1a A G 3: 159,526,691 Y693C possibly damaging Het
Des T C 1: 75,363,477 S343P probably damaging Het
Dync1i2 T C 2: 71,249,863 probably benign Het
Emsy G T 7: 98,600,674 T802K probably damaging Het
Endov A G 11: 119,491,825 T33A probably damaging Het
Epb41l5 G A 1: 119,549,166 T728I probably damaging Het
Fbxo39 A G 11: 72,318,402 I363V probably benign Het
Gm8674 C T 13: 49,900,517 noncoding transcript Het
Gm9733 G T 3: 15,332,152 T24K unknown Het
Il6st T A 13: 112,481,464 N137K possibly damaging Het
Inf2 A G 12: 112,601,344 N136S probably damaging Het
Iqub A T 6: 24,491,559 I376N probably benign Het
Kansl3 A G 1: 36,354,793 probably benign Het
Kbtbd2 A T 6: 56,781,924 H71Q probably damaging Het
Lgals8 G T 13: 12,453,327 Y140* probably null Het
Macf1 T A 4: 123,493,998 I924L probably benign Het
Mcoln2 A T 3: 146,181,814 T329S possibly damaging Het
Mex3d A T 10: 80,381,520 L621Q probably damaging Het
Mut A G 17: 40,937,468 probably benign Het
Ncor1 T C 11: 62,334,631 H1038R probably damaging Het
Neb A G 2: 52,271,297 probably null Het
Ngrn A G 7: 80,264,772 T224A probably benign Het
Nin G A 12: 70,017,650 R2019* probably null Het
Nphp4 C G 4: 152,547,018 Q792E probably damaging Het
Olfr1047 T A 2: 86,228,455 N172I probably damaging Het
Olfr1166 C T 2: 88,124,311 V225I probably benign Het
Olfr140 C T 2: 90,051,671 V218I possibly damaging Het
Olfr373 C T 8: 72,100,176 Q139* probably null Het
Olfr70 C T 4: 43,696,823 V117M probably benign Het
Pde4dip C A 3: 97,724,102 V1164L probably damaging Het
Plppr1 A G 4: 49,301,067 probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Ppp2r5e A G 12: 75,469,536 probably benign Het
Prim2 T A 1: 33,630,404 E163D probably benign Het
Prrc2b A T 2: 32,194,985 D296V probably damaging Het
Pter A G 2: 12,978,621 probably benign Het
Robo2 C A 16: 73,961,910 V662L probably damaging Het
Slco1b2 A T 6: 141,672,200 I424F probably benign Het
Snx29 A T 16: 11,631,471 H260L probably damaging Het
Stil A G 4: 115,039,195 N959S probably benign Het
Taar8c A T 10: 24,101,610 D101E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 G A 9: 8,653,147 M573I probably damaging Het
Tsr1 A T 11: 74,899,599 D171V probably benign Het
Ube4b T C 4: 149,371,169 T348A probably damaging Het
Vmn1r85 A T 7: 13,084,881 I112N probably damaging Het
Vps36 A G 8: 22,218,210 probably null Het
Wdfy3 G A 5: 101,937,738 A630V possibly damaging Het
Wdsub1 A T 2: 59,876,800 D14E probably null Het
Ylpm1 T C 12: 85,030,383 I1294T possibly damaging Het
Zdhhc17 A G 10: 110,955,075 F378L probably benign Het
Other mutations in Eif3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Eif3m APN 2 105012843 intron probably benign
IGL02661:Eif3m APN 2 105004969 missense probably damaging 0.98
IGL02932:Eif3m APN 2 105014869 missense probably damaging 1.00
R0039:Eif3m UTSW 2 105005872 missense probably damaging 1.00
R0373:Eif3m UTSW 2 105005000 missense probably benign 0.06
R1695:Eif3m UTSW 2 105016953 missense probably damaging 0.98
R1934:Eif3m UTSW 2 105001279 missense probably damaging 1.00
R2115:Eif3m UTSW 2 105006796 missense probably damaging 1.00
R2416:Eif3m UTSW 2 105013833 missense probably benign
R4610:Eif3m UTSW 2 105013288 missense probably benign 0.08
R4713:Eif3m UTSW 2 105006839 unclassified probably null
R5373:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5374:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5725:Eif3m UTSW 2 105013841 missense probably damaging 0.97
Z1088:Eif3m UTSW 2 105013256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCTGTTTCACATGCAGTATCAATC -3'
(R):5'- GGGTCTCAGCTTACCTAACACACCTTC -3'

Sequencing Primer
(F):5'- TGCAGTATCAATCCTGAACATGC -3'
(R):5'- GTGATGCTGCATCAAAGGTCAT -3'
Posted On2014-03-14